ID: 1134247660

View in Genome Browser
Species Human (GRCh38)
Location 16:12552021-12552043
Sequence TGGCAAGTCCAGGCTCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134247657_1134247660 -6 Left 1134247657 16:12552004-12552026 CCTGTCTCTAAAAAACGTGGCAA No data
Right 1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG No data
1134247652_1134247660 20 Left 1134247652 16:12551978-12552000 CCATGTCAAAGTAGCTCCTGCTG No data
Right 1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG No data
1134247656_1134247660 -5 Left 1134247656 16:12552003-12552025 CCCTGTCTCTAAAAAACGTGGCA 0: 1
1: 1
2: 5
3: 68
4: 785
Right 1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG No data
1134247654_1134247660 4 Left 1134247654 16:12551994-12552016 CCTGCTGGTCCCTGTCTCTAAAA No data
Right 1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134247660 Original CRISPR TGGCAAGTCCAGGCTCAGAT GGG Intronic
No off target data available for this crispr