ID: 1134247665

View in Genome Browser
Species Human (GRCh38)
Location 16:12552035-12552057
Sequence TCAGATGGGAAGGATTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134247656_1134247665 9 Left 1134247656 16:12552003-12552025 CCCTGTCTCTAAAAAACGTGGCA 0: 1
1: 1
2: 5
3: 68
4: 785
Right 1134247665 16:12552035-12552057 TCAGATGGGAAGGATTTTTGGGG 0: 1
1: 0
2: 2
3: 20
4: 257
1134247654_1134247665 18 Left 1134247654 16:12551994-12552016 CCTGCTGGTCCCTGTCTCTAAAA No data
Right 1134247665 16:12552035-12552057 TCAGATGGGAAGGATTTTTGGGG 0: 1
1: 0
2: 2
3: 20
4: 257
1134247657_1134247665 8 Left 1134247657 16:12552004-12552026 CCTGTCTCTAAAAAACGTGGCAA No data
Right 1134247665 16:12552035-12552057 TCAGATGGGAAGGATTTTTGGGG 0: 1
1: 0
2: 2
3: 20
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134247665 Original CRISPR TCAGATGGGAAGGATTTTTG GGG Intronic
900788575 1:4665188-4665210 TCAGAAGGCAAGGATTCTTTAGG + Intronic
902226692 1:15000631-15000653 ACTGTTGGGAAGAATTTTTGAGG + Intronic
906540316 1:46580681-46580703 TCAGATGGGAAGAACTTTTGTGG + Intronic
909689205 1:78387709-78387731 TGAGATGAGAAGGATATTTGAGG - Intronic
910545271 1:88408681-88408703 CTAGAAGGAAAGGATTTTTGGGG - Intergenic
911588843 1:99722786-99722808 TGAGGTGGCAAGAATTTTTGTGG - Intronic
911782538 1:101900741-101900763 TGAGATGTAAAGGATATTTGAGG + Intronic
912310594 1:108617173-108617195 TCAGATGATAAGGAGTCTTGTGG + Intronic
913984220 1:143550811-143550833 TCAGAAGGGAAGGATTTTCAAGG - Intergenic
917121252 1:171646451-171646473 TCAGATAGTTAGCATTTTTGGGG + Intronic
918444837 1:184606936-184606958 TCAGCTGGGAAGGAATTATGAGG + Intronic
918922844 1:190736557-190736579 TCAGATGGGAAACAATTTGGTGG + Intergenic
919067580 1:192713030-192713052 TGAGATGGTAAGTATTGTTGGGG - Intergenic
922780285 1:228246945-228246967 CCAAATGGGAAGGATATGTGTGG + Intronic
922975455 1:229779985-229780007 GCAGATGGGAAAGATGTGTGTGG + Intergenic
1066446177 10:35485842-35485864 TCAGAAGGGCAGGATTTCTTAGG - Intronic
1067460264 10:46452982-46453004 AGAGATGAGAAGGATGTTTGGGG - Intergenic
1067626926 10:47931621-47931643 AGAGATGAGAAGGATGTTTGGGG + Intergenic
1067751805 10:48976648-48976670 TCAGCTGGAAAGAAGTTTTGGGG + Intronic
1069404272 10:68081576-68081598 TCAGATGGACATGAATTTTGGGG + Intergenic
1070285726 10:75082284-75082306 TCAGGAGGGAAGGATGTCTGCGG + Intergenic
1070347096 10:75555088-75555110 TCTGATGGGGAGGAGTTTGGTGG + Intronic
1071010796 10:80938101-80938123 TGAGATGGGGAGGTTTATTGTGG - Intergenic
1072129838 10:92483709-92483731 TCAGCAGGCAAGGATTGTTGTGG - Intronic
1072417231 10:95259381-95259403 TGAGATAGGAAAGATTTTTCTGG - Intronic
1073755301 10:106574796-106574818 ACAGATGGGAGGGAGCTTTGAGG + Exonic
1074348263 10:112709575-112709597 AAAGATGGGCAGGATTTTTATGG - Intronic
1079610114 11:22422350-22422372 TAAGATTGGAAGGATTATTATGG + Intergenic
1081156152 11:39693745-39693767 TCAAATGGGAAGGAAATGTGTGG - Intergenic
1081251433 11:40839691-40839713 ACAGATGGAAAGGATCCTTGTGG + Intronic
1082932036 11:58618292-58618314 TCAGAAAGGAAGGATATATGGGG + Exonic
1083075672 11:60034515-60034537 TTAGATGGGAAAGATTTCTTTGG + Intergenic
1084361279 11:68669994-68670016 CCAGGTGGGAAGGCCTTTTGGGG - Intergenic
1084408822 11:68994342-68994364 TCAGCTGGGAAGGCGTCTTGTGG - Intergenic
1084580117 11:70017982-70018004 TCTGATGGGATGGATGGTTGGGG - Intergenic
1084584059 11:70045657-70045679 TCATATGGGAAGGGTGTTTAAGG + Intergenic
1087089816 11:94257381-94257403 TCAGATGGGAAGAATAATTTTGG - Intergenic
1087435617 11:98113412-98113434 TCAGTTGGGGAGGGTATTTGGGG - Intergenic
1087750450 11:102001634-102001656 TGAGATGGGAAGGTGGTTTGAGG - Intergenic
1088463827 11:110112115-110112137 ACATATGTGAAGGATTTTTGAGG - Intronic
1088923304 11:114277528-114277550 TGAGATGTAAAGGATATTTGAGG + Intronic
1089222394 11:116884707-116884729 TGAGATGGGAAGATTGTTTGAGG - Intronic
1089311671 11:117562112-117562134 TCAGAGGGGCAGGCTTTCTGGGG + Intronic
1089314946 11:117585218-117585240 TCAAATGGAAAGGATTTGGGGGG + Intronic
1089861031 11:121590153-121590175 TCTGATGAGAAGGATTGTGGAGG + Exonic
1090454282 11:126834448-126834470 TCTGATAGAAAGGATTCTTGGGG - Intronic
1091656955 12:2353118-2353140 TCAGGTGGGAGGGAGTTTAGAGG + Intronic
1092028683 12:5264974-5264996 TGAGATTGGAAGGAATATTGTGG - Intergenic
1093332914 12:17864965-17864987 TCAGAGGTGAATGAATTTTGAGG - Intergenic
1093733793 12:22595552-22595574 TCAGGTGGGAAAGATGTCTGGGG - Intergenic
1096282191 12:50265872-50265894 GGAGATGGGAAGGATGTTTGTGG - Intronic
1097010978 12:55953352-55953374 TTGCATGGGAAGGGTTTTTGTGG - Exonic
1097943182 12:65335251-65335273 TCACATTGTAAGGATTTTTTAGG - Intronic
1098784025 12:74726497-74726519 TCAGATGTGCAGAATTGTTGGGG - Intergenic
1100427822 12:94503109-94503131 CCAGTTGGGAGGGATTGTTGAGG - Intergenic
1100821836 12:98439042-98439064 TCCAATGGGAAGCATTTGTGGGG + Intergenic
1101464279 12:104931641-104931663 TCAGAGGGGAAGGCCTTTGGGGG + Intronic
1102767620 12:115447452-115447474 TCACATGGAAAGTGTTTTTGTGG - Intergenic
1103165824 12:118769571-118769593 TGAGATTGGAGTGATTTTTGAGG - Intergenic
1104558250 12:129821573-129821595 TCAGATCGAATGGGTTTTTGAGG - Intronic
1107199250 13:37694097-37694119 TCTGATGGGAAGGATTATACGGG - Intronic
1109723398 13:66306662-66306684 TCAGATGGGAAGTAATTTTAAGG - Intronic
1114910066 14:27181330-27181352 TGAGATGGGAATAATTGTTGAGG - Intergenic
1115494507 14:33989404-33989426 TCAGAGCTGAAGGAATTTTGGGG + Intronic
1116536680 14:46040537-46040559 TGAGATTGGAAATATTTTTGTGG + Intergenic
1121833583 14:97072489-97072511 TCAGAGCGGAAGGATTTTGAAGG + Intergenic
1122648283 14:103209467-103209489 TCAGAAGGGCAGGACTGTTGGGG - Intergenic
1123487509 15:20755396-20755418 TTAGGTGGGAAGGATGGTTGGGG - Intergenic
1123544001 15:21324454-21324476 TTAGGTGGGAAGGATGGTTGGGG - Intergenic
1123663114 15:22583271-22583293 TCAGATTGAAAGGCTTTTTTGGG - Intergenic
1123958524 15:25366983-25367005 TCAGATGTGAAGGCAGTTTGAGG + Intronic
1124185149 15:27518653-27518675 GCAGATGGGAAGGAATTCAGAGG + Intronic
1124259189 15:28172571-28172593 TCAGATTGAAAGGCTTTTTTTGG - Intronic
1124316916 15:28677574-28677596 TCAGATTGAAAGGCTTTTTTGGG - Intergenic
1124566537 15:30819930-30819952 TCAGATTGAAAGGCTTTTTTGGG + Intergenic
1124601157 15:31133805-31133827 GCAGATGGAAAGTATTTGTGGGG + Intronic
1124857493 15:33404857-33404879 TCAGATGTCAAGTATTTTAGGGG + Intronic
1126321779 15:47431699-47431721 TCACACAGGAAGCATTTTTGTGG - Intronic
1126642263 15:50840219-50840241 TGAGATGGGCAGGAGTTTTGGGG - Intergenic
1127495181 15:59504263-59504285 TGACATGGGAATGATTTGTGAGG + Intronic
1127800531 15:62473462-62473484 TGAGATGGGAAGGACTTCTAAGG - Intronic
1130092476 15:80832527-80832549 TTAGATCGGAATGAGTTTTGGGG + Intronic
1131022222 15:89108519-89108541 TCAGATGGACATGAATTTTGTGG + Intronic
1131940699 15:97561850-97561872 CCAGGTGGGAAGGATTTCTATGG + Intergenic
1133926100 16:10193832-10193854 TGGGATGGGAAGTATTATTGTGG - Intergenic
1134133610 16:11666136-11666158 TTAGAGGGGAAAGATTCTTGGGG - Intergenic
1134247665 16:12552035-12552057 TCAGATGGGAAGGATTTTTGGGG + Intronic
1135238623 16:20782648-20782670 TGAGATGGGAAAGAGTCTTGTGG - Intronic
1135287347 16:21205551-21205573 TCAGATGGGATGGAGCATTGAGG - Exonic
1135329582 16:21550144-21550166 TCAGATGTGAAGGATTTCCTGGG - Intergenic
1135700993 16:24632333-24632355 TCAGTTGGGAAAGATATTGGAGG - Intergenic
1135728501 16:24875545-24875567 GCAGATGGGAAGGGCTTGTGTGG + Intronic
1136339920 16:29636099-29636121 TCAGATGTGAAGGATTTCCTGGG - Intergenic
1137457222 16:48627085-48627107 ACAGATGGGAGGGATTTTGGAGG + Intergenic
1137468970 16:48737499-48737521 TCAGGGGGTAAGGATTATTGGGG + Intergenic
1138356562 16:56385790-56385812 GCAGAGTGGAAGGATTTTTAGGG - Intronic
1142042597 16:87904675-87904697 TCAGATGTGAAGGATTTCCTGGG - Intronic
1143415952 17:6750396-6750418 TGAGATAGGAAGGACATTTGAGG - Intergenic
1144817254 17:18043955-18043977 TCACATCAGGAGGATTTTTGAGG + Intronic
1147000278 17:37357796-37357818 TGTGATGAGAAGGATTTCTGTGG - Intronic
1150510522 17:65747672-65747694 TCTGATGGAAATGATATTTGGGG + Intronic
1151222212 17:72621536-72621558 TCAAATGAGAAGGACTTTGGAGG - Intergenic
1151304989 17:73257604-73257626 TGAGATGGGAAGGTTTCTAGAGG - Intronic
1151395105 17:73818031-73818053 TCTGATGACGAGGATTTTTGAGG + Intergenic
1152185547 17:78854551-78854573 TAGGAAGGGAAGGATTTTGGAGG - Exonic
1152323632 17:79623090-79623112 TCAGCTGGGAAGGATTCTGCTGG - Intergenic
1153962121 18:10148766-10148788 TCAGATGGAAATGATTTCTCAGG - Intergenic
1155351745 18:24913980-24914002 ACAGATGGGAAGGACCTATGAGG - Intergenic
1155408936 18:25520508-25520530 TCAGCTGGGAGGGAATATTGTGG + Intergenic
1155706577 18:28823442-28823464 TCAGCTGTGTAGGATTTTTTTGG + Intergenic
1155762265 18:29583384-29583406 TCACACGGAAAGGATTTCTGGGG + Intergenic
1156785885 18:40914652-40914674 TCAGCTGGGAAAGATTTTAATGG - Intergenic
1157589871 18:48829871-48829893 TCAGATGTGAATGATGTTTAGGG + Intronic
1157780864 18:50438078-50438100 TCAGGTAGGAAGGAACTTTGGGG - Intergenic
1160375460 18:78408568-78408590 TCAGCTGGGAAGACTATTTGTGG - Intergenic
1160417630 18:78722075-78722097 TCAGTTGCAAATGATTTTTGGGG + Intergenic
1162938340 19:13993337-13993359 TCTGGTGGGAAGGAGTTTGGGGG + Intronic
1163214983 19:15869924-15869946 GCAGCTGGGAAGGAGGTTTGAGG + Intergenic
1163252761 19:16136052-16136074 TCAGGTGGGAAGGGAGTTTGTGG - Intronic
1163318305 19:16556516-16556538 TCAGATGGTAAAGTTTTGTGGGG - Intronic
1163422166 19:17219887-17219909 TGAGATGGGAGGGTTTTTGGAGG + Intergenic
1163488628 19:17604505-17604527 TCAGATGGGGAGGCTTTCCGAGG - Exonic
1164463754 19:28470316-28470338 TCAGAGGGGAAGGCTGTTAGTGG - Intergenic
1164987476 19:32658970-32658992 CCAGATAGAAAGGATTTTTCAGG + Exonic
1167493081 19:49802907-49802929 TGAGATGGGAAGGAACTTGGTGG - Intronic
1168198377 19:54793197-54793219 TCAGCTGGTAAGGATTTATAGGG - Intronic
1168464473 19:56590390-56590412 TCAGAAGGGAGGGGTTGTTGGGG - Intergenic
925169505 2:1742607-1742629 CCAGATGGGAAAAATCTTTGAGG + Intronic
926731165 2:16036799-16036821 TTAGATGGCTAGGATTTTTGGGG + Intergenic
929870473 2:45754898-45754920 CCAGGAGGGAAGGATTTTTCTGG + Intronic
930323930 2:49889157-49889179 TCAGAAGGAAAGGAAGTTTGAGG - Intergenic
931725490 2:65106182-65106204 TGAGTTGGGAAGGATCTATGAGG - Intronic
932279684 2:70479910-70479932 TCATATGAGAAGATTTTTTGAGG - Intronic
935023438 2:99253763-99253785 TCAGATGTGAAAGGCTTTTGGGG - Intronic
936175949 2:110219984-110220006 TGAGAGGGAAGGGATTTTTGTGG + Intergenic
936922266 2:117701237-117701259 CCAGATGAGAAGAAGTTTTGTGG - Intergenic
937015883 2:118604996-118605018 TCACATGGGAAGGACTCTTCTGG - Intergenic
937952871 2:127401823-127401845 TCGGATGGGTAGGCATTTTGAGG - Intergenic
938141531 2:128798674-128798696 TCAGATGGGGAGGAAATCTGAGG + Intergenic
938899507 2:135787957-135787979 TCTTATAGGAAGGATTTTTACGG + Exonic
938966333 2:136391917-136391939 TCAGGTGTGAAGGAAATTTGGGG - Intergenic
940190686 2:151037236-151037258 TCAGATGGAAAAGATTCATGGGG - Intronic
940905695 2:159167524-159167546 TCTAATGGGAAAGATTTGTGTGG + Intronic
942592363 2:177559655-177559677 TTGGATGGGAAGGATCTTTGAGG + Intergenic
943447994 2:188013478-188013500 TAAGATGGGAAAGATTTAAGGGG + Intergenic
945121249 2:206459748-206459770 CCAGATGGGAAGGATTTGGGAGG - Intronic
945905429 2:215587671-215587693 ACACATGGGATGGCTTTTTGAGG + Intergenic
946133107 2:217622840-217622862 TGATATGGGAATGGTTTTTGGGG - Intronic
946933476 2:224695343-224695365 TCTTATGGGAAGGAACTTTGGGG + Intergenic
948604187 2:239124286-239124308 GCAGATGGGGAGCATTTCTGGGG - Intronic
1169209617 20:3758868-3758890 TCTCAGGGGATGGATTTTTGTGG - Intronic
1170307147 20:14951081-14951103 TCAGTTGGGAATGAGTCTTGAGG + Intronic
1171075985 20:22123882-22123904 TAACATGGGAAAGATTTTAGAGG - Intergenic
1171379016 20:24719051-24719073 CCATTTTGGAAGGATTTTTGGGG - Intergenic
1171472653 20:25384346-25384368 TCAGATGAGAACAATTTTGGAGG - Intronic
1173161910 20:40659010-40659032 TCAGAGGTGAAGGATTGTTCTGG + Intergenic
1173355156 20:42280311-42280333 TCAGATAAGAAGGATGCTTGGGG - Intronic
1174117015 20:48233262-48233284 TCACATGTAAAGGATATTTGGGG + Intergenic
1174173280 20:48629968-48629990 GCAGAAGGGAAGGCTTTTTCTGG - Intronic
1175180637 20:57144232-57144254 TCAGATGGTAACTATTCTTGGGG - Intergenic
1176944841 21:14966974-14966996 TGAGAGAGGAAGCATTTTTGAGG - Exonic
1178289789 21:31357314-31357336 TCAGATGGGAAGAAATTGTTGGG - Intronic
1178678487 21:34651688-34651710 TCAAAGGGATAGGATTTTTGGGG + Intergenic
1180747354 22:18099216-18099238 GCAGATGGGTAGGATTTGGGTGG + Exonic
1182985750 22:34714495-34714517 TCAGATGGACATGAGTTTTGGGG - Intergenic
1184342729 22:43894829-43894851 TCACATGGGGAAGTTTTTTGCGG - Intergenic
1185359053 22:50394243-50394265 TCACATGGGGTGGATTTTTACGG - Intronic
951567529 3:24026191-24026213 TGTGAGGGGCAGGATTTTTGTGG + Intergenic
951774782 3:26297724-26297746 CCAGAAGGCAAGGATTATTGGGG - Intergenic
952145625 3:30528839-30528861 TGAGATGGGAAGGATCTGGGTGG - Intergenic
953966806 3:47314230-47314252 TAAGGTGGGAAGGTTTCTTGAGG - Intronic
953982867 3:47421357-47421379 TCAGTGGGGAAGGACTTTTTGGG - Intronic
955102918 3:55869606-55869628 CCAGATGGGAAGGAGTCATGTGG - Intronic
955544886 3:60017883-60017905 TAGGATGGGAGGGATTCTTGTGG - Intronic
956097752 3:65735282-65735304 ACAGAAGTTAAGGATTTTTGGGG + Intronic
957176181 3:76812444-76812466 AAATCTGGGAAGGATTTTTGGGG + Intronic
957363640 3:79192850-79192872 TAGGAGGGGAAGGATTTTTGGGG + Intronic
958910710 3:99991095-99991117 GGAGATGGGAAGAATTTTTTTGG - Intronic
960289589 3:115867429-115867451 TCAAAAGGGGAGGATTTGTGGGG - Intronic
960832451 3:121864078-121864100 TCAGAAGGGAGGTATTTTTGGGG + Intronic
962297191 3:134201365-134201387 GCAGCTGGGAAGCATATTTGTGG - Intronic
963152860 3:142065054-142065076 TCAGATGGTAAAGGTTTTTCAGG + Intronic
963273749 3:143310162-143310184 TCAACTGGAAAGGATTTTTTGGG + Intronic
965154588 3:165032213-165032235 TCAGATTTGAAGAATTTTTATGG + Intronic
966011440 3:175083211-175083233 TCAGATGTGAAGGTTGTTTCCGG - Intronic
966069129 3:175853652-175853674 TTAGATGGGAGGGTTGTTTGGGG - Intergenic
967830637 3:193916605-193916627 TCAGGTGGGCAGGTTTTTTCAGG - Intergenic
968067082 3:195764687-195764709 CCAGATGAGCAGGATGTTTGGGG - Intronic
970464842 4:16312137-16312159 TAAGATGGGAAGGTTTTTCTAGG + Intergenic
970814675 4:20140274-20140296 ACTGGTGGGAAGGAGTTTTGAGG + Intergenic
971939693 4:33199178-33199200 AGAGATTGGAATGATTTTTGAGG + Intergenic
972977375 4:44653125-44653147 TCAGATGGCAAGGAGTTTTGTGG + Intronic
973612101 4:52645650-52645672 ACAGATGGGAAGTGTATTTGTGG - Intronic
974057806 4:57001748-57001770 TTTTATGGGAAGGATTTTTGAGG + Intronic
974646328 4:64697908-64697930 TAAGAGGGGAGGGATCTTTGTGG + Intergenic
975482168 4:74892907-74892929 TCAAATGAGAATGATTCTTGTGG + Intergenic
976826999 4:89271984-89272006 TCACATGGGAAGGAGGTTTTTGG - Intronic
978304973 4:107317656-107317678 TGAGATTGGAAGAATTTATGAGG + Intergenic
979084582 4:116390791-116390813 TGAATTGGGATGGATTTTTGTGG + Intergenic
979343755 4:119560526-119560548 TTAAATGGGAAGCAGTTTTGAGG - Intronic
980984384 4:139681824-139681846 CAAGAGGGCAAGGATTTTTGTGG - Intronic
981367918 4:143924781-143924803 AGAGATGAGAAGGATTTTTAAGG + Intergenic
981377712 4:144035057-144035079 AGAGATGAGAAGGATTTTTAAGG + Intergenic
982365102 4:154569277-154569299 ACAGATGGGAAGAATTACTGTGG + Exonic
983135225 4:164070654-164070676 TCATTTTGGAAGGATTTTTAAGG + Intronic
983642182 4:169953314-169953336 GCAGATAGGAAAGATGTTTGGGG + Intergenic
984192038 4:176617620-176617642 TAAAATGGGAAGGAATCTTGAGG + Intergenic
987384559 5:17316747-17316769 TCAGATGGGAATGAGTGTGGGGG - Intergenic
990250263 5:53906877-53906899 GCAGATGGGAAGGACTGGTGTGG - Intronic
991706030 5:69359573-69359595 GCAGCTGGGAAGGTTTTTTAAGG - Intronic
992282729 5:75198556-75198578 TCTGAGGAGAAGGATTTTTTTGG - Intronic
995126326 5:108580149-108580171 CCAGGTGGCAAGGATTATTGGGG - Intergenic
995801619 5:116002391-116002413 TCAGATGGGGAGAATGCTTGAGG + Intronic
996405544 5:123099389-123099411 CCAGATCCGAAGGCTTTTTGGGG + Intronic
997609568 5:135206102-135206124 TCAGATGGGAGGTATTCCTGTGG + Intronic
998621105 5:143794998-143795020 CCAGGTGGGAAAGTTTTTTGTGG + Intergenic
999054778 5:148562702-148562724 TCATATGGGAAGCAGGTTTGAGG - Intronic
999432902 5:151539149-151539171 TCAGAAGGGAGGCTTTTTTGGGG - Intronic
1000384192 5:160658331-160658353 TCAGAAGGGAAGGGCTTTTTGGG + Intronic
1001107549 5:168868108-168868130 TTAGAGGAGAAGGAGTTTTGGGG - Intronic
1001623535 5:173109716-173109738 TGAGTTGCAAAGGATTTTTGAGG + Intronic
1001908368 5:175492712-175492734 TCAGATGGGAAGGGTGCTGGTGG + Intronic
1003276106 6:4654676-4654698 TAAGATGGGAAGGTGTTTTCTGG - Intergenic
1003672104 6:8169362-8169384 TCAGATAGGAATGATATTCGGGG - Intergenic
1004968038 6:20877134-20877156 TGTGATGGGAAAGACTTTTGTGG + Intronic
1005145428 6:22684764-22684786 TCATATGGGAAGGATGGTTCGGG - Intergenic
1007020070 6:38511196-38511218 TCAGGTGGGAAGGTTATTTGGGG - Intronic
1008666024 6:53717319-53717341 TCAGATGTGAAGGCAATTTGGGG - Intergenic
1009025158 6:57990616-57990638 CAAGCTGGGAAGGAATTTTGAGG - Intergenic
1010097214 6:72060614-72060636 ACAGATGGGAAGGAATTTGAGGG - Intronic
1010744269 6:79542903-79542925 TAAGATGGTAAGAAGTTTTGTGG - Intergenic
1010947672 6:81997310-81997332 ACAGCTGGGAAGGAATTTTATGG - Intergenic
1013344163 6:109243924-109243946 TCAGATGTGAATGTTTTGTGGGG + Intergenic
1013608201 6:111770448-111770470 TCAGATGGGAAGAAACATTGTGG + Intronic
1014873097 6:126621181-126621203 TCAGGAGGGAAATATTTTTGGGG + Intergenic
1015450123 6:133357536-133357558 TGAGAATGGAAGGATATTTGGGG - Intronic
1015511976 6:134046981-134047003 TCAGCTGGGAAGTATTTTGGGGG + Intronic
1016772739 6:147870282-147870304 ACAGGTGGGAAGGATTCTTCCGG - Intergenic
1020994222 7:15242101-15242123 TCAAAAGAGAGGGATTTTTGGGG - Intronic
1021159509 7:17254608-17254630 TAGCATGAGAAGGATTTTTGGGG + Intergenic
1022065527 7:26851795-26851817 GTAGAAGGGAAGGATTTGTGAGG + Intronic
1023226718 7:37977597-37977619 TGAGATGGGAAGGAGTTTGCTGG + Intronic
1026679238 7:72452770-72452792 TAAGGTGGGAGTGATTTTTGTGG + Intergenic
1027334629 7:77135388-77135410 TAAGATGGGAAGACTGTTTGAGG + Intronic
1028515874 7:91677833-91677855 TCAGAGGGGAAGACATTTTGAGG - Intergenic
1030842717 7:114375952-114375974 CAAGATGGGAAGAATTTTTGGGG + Intronic
1031055168 7:116985260-116985282 TGAGATGGGAAGAATTAATGTGG + Intronic
1031671046 7:124546205-124546227 ACATATGAGAAGGATGTTTGTGG - Intergenic
1033437669 7:141348348-141348370 TCAGATGGACAGGATTCATGTGG + Intronic
1033890036 7:146000826-146000848 TAAACTAGGAAGGATTTTTGAGG - Intergenic
1035854842 8:2963770-2963792 ACAGATGGTAAGAATTTTTCTGG + Intronic
1036382382 8:8245357-8245379 TCAGAAGGGAAGCATTGTCGAGG - Intergenic
1037877971 8:22558048-22558070 TCACTAGGGAAAGATTTTTGTGG + Intronic
1038135106 8:24776976-24776998 TCACGTGCGAAGGACTTTTGAGG + Intergenic
1038207513 8:25481299-25481321 TCAGATGTTAAGTCTTTTTGAGG - Intronic
1038860099 8:31377483-31377505 TCAGAAGGGATGGATGGTTGTGG + Intergenic
1039409856 8:37343683-37343705 TCAGAGGGGAAGAAGTTTAGAGG - Intergenic
1040976919 8:53203793-53203815 TCAGATGAGAAAGGTTTTTATGG - Intergenic
1045819190 8:106315507-106315529 TCAGAAAAGAAGGATTTTTAAGG - Intronic
1046425805 8:114046568-114046590 TCACATGGGAAGGATTACTGTGG + Intergenic
1051529039 9:18079171-18079193 TGAGAAAAGAAGGATTTTTGGGG - Intergenic
1052113996 9:24626485-24626507 TCCTATGGGAAGGGATTTTGAGG + Intergenic
1055054777 9:72013675-72013697 TCAAATGGGAATGAGCTTTGAGG - Intergenic
1055320755 9:75081358-75081380 CCAGATGGGAAGATTGTTTGAGG + Intronic
1055591290 9:77817165-77817187 TCAGAGGGGAACGATGATTGAGG - Intronic
1055664587 9:78540636-78540658 TCATATAGCAAGGGTTTTTGTGG + Intergenic
1057500639 9:95594470-95594492 GCTGAGGGGAAGGATTTGTGGGG + Intergenic
1057554877 9:96080014-96080036 TGAGTTGGGAAGGATATGTGAGG + Intergenic
1058528533 9:105884006-105884028 TCAGAAGAGAAGGAAGTTTGTGG + Intergenic
1058954447 9:109932213-109932235 CCAAATGGGAAGGAGTTCTGAGG + Intronic
1185883433 X:3760315-3760337 TCAAATGGCAAGAATTTTTGAGG - Intergenic
1186723147 X:12327489-12327511 TCAGATTGGAAATATTTTTGAGG - Intronic
1187092129 X:16107693-16107715 TGAGAAGGGAATGAATTTTGAGG + Intergenic
1187248749 X:17577663-17577685 TCAAATGTGAATGATTTCTGAGG - Intronic
1191899435 X:66025508-66025530 TGTGATGGGAAGAATCTTTGTGG - Intronic
1195747475 X:108133260-108133282 TCTAATGGGACAGATTTTTGAGG - Intronic
1196335548 X:114528142-114528164 TCAGTTGGAAATGATTTTTTTGG + Intergenic
1198880243 X:141273225-141273247 TCAGATGTCAAGGAATTCTGTGG + Intergenic
1200667017 Y:6037548-6037570 TCAAATGGTAAGAATCTTTGCGG + Intergenic
1201382932 Y:13404032-13404054 TCAAATGAAAAGGATATTTGAGG - Intronic