ID: 1134249166

View in Genome Browser
Species Human (GRCh38)
Location 16:12562273-12562295
Sequence TTTGATGCTGGGATAGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134249166_1134249171 12 Left 1134249166 16:12562273-12562295 CCACGCTCTATCCCAGCATCAAA No data
Right 1134249171 16:12562308-12562330 CTTTGTCCCAAGAACCTGCAGGG No data
1134249166_1134249170 11 Left 1134249166 16:12562273-12562295 CCACGCTCTATCCCAGCATCAAA No data
Right 1134249170 16:12562307-12562329 GCTTTGTCCCAAGAACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134249166 Original CRISPR TTTGATGCTGGGATAGAGCG TGG (reversed) Intronic