ID: 1134250976

View in Genome Browser
Species Human (GRCh38)
Location 16:12573676-12573698
Sequence GAGGATGCCCTTGCAAAAAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134250972_1134250976 11 Left 1134250972 16:12573642-12573664 CCACCACTCATTCACTGTCAGTG 0: 1
1: 0
2: 2
3: 9
4: 177
Right 1134250976 16:12573676-12573698 GAGGATGCCCTTGCAAAAATTGG 0: 1
1: 0
2: 0
3: 6
4: 79
1134250973_1134250976 8 Left 1134250973 16:12573645-12573667 CCACTCATTCACTGTCAGTGTAG 0: 1
1: 0
2: 2
3: 10
4: 132
Right 1134250976 16:12573676-12573698 GAGGATGCCCTTGCAAAAATTGG 0: 1
1: 0
2: 0
3: 6
4: 79
1134250971_1134250976 30 Left 1134250971 16:12573623-12573645 CCATGAACGGCAAGGGGAACCAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1134250976 16:12573676-12573698 GAGGATGCCCTTGCAAAAATTGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134250976 Original CRISPR GAGGATGCCCTTGCAAAAAT TGG Exonic
902168373 1:14591031-14591053 GAGGGTGCCTTCGCTAAAATGGG + Intergenic
906881048 1:49591269-49591291 GAGAATGACCTTGAAAAAAAGGG + Intronic
909463935 1:75951367-75951389 GAGAATACCCATGCAAACATGGG + Intergenic
909507096 1:76404834-76404856 AAGGATGCCATTTTAAAAATTGG - Intronic
912231506 1:107798288-107798310 GACGATGCCTGTGTAAAAATAGG + Intronic
914076150 1:144353059-144353081 GAGGCTGCCCTAGCAATGATAGG - Intergenic
914103028 1:144613437-144613459 GAGGCTGCCCTAGCAATGATAGG + Intergenic
914394166 1:147249067-147249089 AAGGAAGCCCTTGGAAAAAAAGG - Intronic
922045606 1:221942751-221942773 GAGGATGCAATTGGAAACATTGG - Intergenic
923394435 1:233546860-233546882 GAGGATGCCTTTACAAATTTAGG - Intergenic
924121985 1:240810041-240810063 GAAGATGCCTTTGGAAAAAGAGG - Intronic
924797744 1:247304569-247304591 GAGACTGCACTGGCAAAAATGGG - Intronic
924927033 1:248693145-248693167 CAGGATGCCCTGGCAGCAATGGG - Intergenic
1072536694 10:96369785-96369807 GGGAAAGCCTTTGCAAAAATAGG + Intronic
1072795904 10:98354458-98354480 AAGGATGCCTTTTAAAAAATAGG + Intergenic
1079352145 11:19700673-19700695 GAGGATGACCAGGCAAGAATAGG - Intronic
1081342941 11:41949941-41949963 GAGCAGCCCCTGGCAAAAATAGG - Intergenic
1082900215 11:58240965-58240987 AAGGATGCCCTTTCAATAAATGG - Intergenic
1083124006 11:60545008-60545030 CAGGAGGACCCTGCAAAAATGGG - Intergenic
1084550207 11:69836548-69836570 GAGGATCCCCTTCCACAGATGGG + Intergenic
1086446286 11:86874385-86874407 CAGGATGCCCATGCAATATTTGG - Intronic
1087709538 11:101533048-101533070 GAGGAAGCACTTAGAAAAATGGG + Intronic
1091219962 11:133924785-133924807 GAGGGTGCTCTTGCAACTATAGG - Intronic
1091531961 12:1366636-1366658 GACGATGACCTTGGAAAAGTAGG + Intronic
1097497907 12:60365354-60365376 GAGGAAGCCCGTGCAAATATAGG + Intergenic
1103207857 12:119144188-119144210 GAGGATGCGCTTGCAACAGAGGG - Intronic
1103248721 12:119481251-119481273 AAGCATCTCCTTGCAAAAATAGG + Intronic
1103360008 12:120347865-120347887 CAGGATGCCCTTGGCAAAACAGG + Intronic
1108576156 13:51793246-51793268 GAGGATGCCGTTGCATTCATTGG - Intronic
1109103313 13:58214376-58214398 GAGGATTTCTTTGCAAAATTAGG + Intergenic
1117144371 14:52822299-52822321 GAGGAAGCCATTGCTAACATTGG + Intergenic
1121510969 14:94513193-94513215 GAGTATGCCCTTGCAGATAAGGG - Intronic
1123395038 15:19925323-19925345 GAGGCTGCCCTAGCAATACTAGG - Intergenic
1125376269 15:39033178-39033200 GAAGATGAGGTTGCAAAAATAGG - Intergenic
1128816760 15:70615688-70615710 GAGGACGCCCTCACAAAACTAGG + Intergenic
1129891432 15:79074434-79074456 GAGGCTGTCCTTGCAATACTGGG - Intronic
1130210908 15:81920453-81920475 GAGGAAGGACTTGAAAAAATGGG - Intergenic
1134250976 16:12573676-12573698 GAGGATGCCCTTGCAAAAATTGG + Exonic
1137805099 16:51297473-51297495 GAGGCTGCCCTTCCAAATTTTGG + Intergenic
1141441131 16:84030337-84030359 GAGGAGGCCCTGGTAAAAACAGG - Intronic
1145968534 17:28939307-28939329 GATGATGCTTTTGCAAAAAATGG + Intronic
1148003007 17:44401182-44401204 GGGGACCCCATTGCAAAAATTGG - Exonic
1151995357 17:77604901-77604923 GAAGATGCCATTGCGAAAGTGGG - Intergenic
1154979280 18:21489176-21489198 GAGGATCCCTTTGTTAAAATCGG - Intronic
1157941523 18:51934015-51934037 GAAGATGCCCTACCAGAAATGGG - Intergenic
1158903559 18:61988609-61988631 TAGGAGGCCCTTGCAATGATCGG + Intergenic
1165866495 19:38942713-38942735 GCGGATGCCCTTGCCAAAGTTGG + Exonic
1168495554 19:56845319-56845341 GAGTATCCCCTTTCAAATATAGG - Intergenic
927459046 2:23281851-23281873 GAGGATGCCCTCGGCCAAATAGG - Intergenic
928706571 2:33955978-33956000 GAGGATGCCCTTACTGAAATGGG - Intergenic
931375930 2:61708325-61708347 GAGGAAGCCCTTTACAAAATGGG + Intergenic
933687307 2:85152970-85152992 GAGCATGCCCTTTCAAAAACAGG - Intronic
941594676 2:167461045-167461067 GAGGAAGGGCTTGCAACAATGGG + Intergenic
944193713 2:197030007-197030029 TAGGATGCCTTTGGAAATATGGG - Intronic
947277259 2:228406561-228406583 GAGGATGGGTTTGGAAAAATGGG + Intergenic
947543948 2:230997545-230997567 TAGGATGCCCATGCAATACTGGG - Intronic
1174202068 20:48813579-48813601 CAGGATGCCCCTGCAAACCTTGG - Intronic
1178019627 21:28394223-28394245 GAAGATGCCCATGGGAAAATAGG + Intergenic
1184868272 22:47216219-47216241 GAAGAATCCCCTGCAAAAATGGG - Intergenic
955609405 3:60741158-60741180 CAGAATGCTCTTGCAAAAACAGG - Intronic
956271394 3:67451124-67451146 GTGGAGGCCACTGCAAAAATTGG - Intronic
957766814 3:84635854-84635876 GAAGATGCCATTTCACAAATGGG + Intergenic
960454824 3:117858157-117858179 GATGATGCTTTTACAAAAATTGG + Intergenic
966378302 3:179319456-179319478 GCGTCTGCCCTTGCAAAATTTGG - Intergenic
966734066 3:183175133-183175155 GGGGATGCCTTTCCAAAAGTGGG - Intergenic
973695009 4:53482101-53482123 GATGATGCCTTTTCAAAGATTGG - Intronic
981358041 4:143814368-143814390 AATGATGCTCTTGCAAGAATTGG + Intergenic
981369286 4:143940477-143940499 AATGATGCTCTTGCAAGAATTGG + Intergenic
994879112 5:105462961-105462983 GGGGCTGCCCTAGCAGAAATTGG - Intergenic
995964108 5:117883397-117883419 GAGAATCCCCTTGAAAAAAGAGG - Intergenic
997139568 5:131364225-131364247 GAGGATGACGTTGGAGAAATGGG + Intronic
1000871201 5:166579693-166579715 GAGGATGCAGTTACAATAATGGG - Intergenic
1003285236 6:4728417-4728439 GAGGAAGCCCATGCAAGGATGGG - Intronic
1004355012 6:14923143-14923165 CAATATGCCCTTTCAAAAATTGG - Intergenic
1010339239 6:74728620-74728642 GCAGATGCCCTTGCAATAACTGG - Intergenic
1012874308 6:104707999-104708021 GAGGATGTCCATCCAAGAATAGG + Intergenic
1018045472 6:159962242-159962264 GGGGAGGCACTTGCAAAGATGGG - Intergenic
1025601948 7:63009638-63009660 GAGCATGCCCTGGCACATATTGG + Intergenic
1027507518 7:79036267-79036289 GAGGAAGCCAATGTAAAAATAGG + Intronic
1034154328 7:148942587-148942609 AAAAATGCCCTTGAAAAAATTGG + Intergenic
1039264040 8:35805213-35805235 AAGGATGCCCTGGAAAAAAAGGG + Intergenic
1039630347 8:39105834-39105856 GAGGATGCACTTCTAAAAGTCGG - Intergenic
1042944966 8:74145307-74145329 GAGGAAGGCTTTGCAAAAATGGG - Intergenic
1047059585 8:121209488-121209510 AAAAATGCCATTGCAAAAATTGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1059470299 9:114499974-114499996 GAGAATGCCCTTAAAAAAATCGG - Intronic