ID: 1134252371

View in Genome Browser
Species Human (GRCh38)
Location 16:12583357-12583379
Sequence GACCCACTGTGTCTCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134252367_1134252371 9 Left 1134252367 16:12583325-12583347 CCTCAGCTGTTACAGCTCAGAGC No data
Right 1134252371 16:12583357-12583379 GACCCACTGTGTCTCAGTGATGG No data
1134252365_1134252371 16 Left 1134252365 16:12583318-12583340 CCTATGCCCTCAGCTGTTACAGC No data
Right 1134252371 16:12583357-12583379 GACCCACTGTGTCTCAGTGATGG No data
1134252366_1134252371 10 Left 1134252366 16:12583324-12583346 CCCTCAGCTGTTACAGCTCAGAG No data
Right 1134252371 16:12583357-12583379 GACCCACTGTGTCTCAGTGATGG No data
1134252363_1134252371 26 Left 1134252363 16:12583308-12583330 CCAACTAGACCCTATGCCCTCAG No data
Right 1134252371 16:12583357-12583379 GACCCACTGTGTCTCAGTGATGG No data
1134252364_1134252371 17 Left 1134252364 16:12583317-12583339 CCCTATGCCCTCAGCTGTTACAG No data
Right 1134252371 16:12583357-12583379 GACCCACTGTGTCTCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134252371 Original CRISPR GACCCACTGTGTCTCAGTGA TGG Intergenic
No off target data available for this crispr