ID: 1134252655

View in Genome Browser
Species Human (GRCh38)
Location 16:12585414-12585436
Sequence CACTGAGAAATGCCTAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134252652_1134252655 -10 Left 1134252652 16:12585401-12585423 CCACACATCCTTGCACTGAGAAA No data
Right 1134252655 16:12585414-12585436 CACTGAGAAATGCCTAGGACTGG No data
1134252651_1134252655 -3 Left 1134252651 16:12585394-12585416 CCTGGAGCCACACATCCTTGCAC No data
Right 1134252655 16:12585414-12585436 CACTGAGAAATGCCTAGGACTGG No data
1134252649_1134252655 25 Left 1134252649 16:12585366-12585388 CCAAGTCTTGGTAAAGAGACAGA No data
Right 1134252655 16:12585414-12585436 CACTGAGAAATGCCTAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134252655 Original CRISPR CACTGAGAAATGCCTAGGAC TGG Intergenic
No off target data available for this crispr