ID: 1134254720

View in Genome Browser
Species Human (GRCh38)
Location 16:12601591-12601613
Sequence CTGCACTTGGCTCATGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134254720_1134254722 -9 Left 1134254720 16:12601591-12601613 CCAGTGGCATGAGCCAAGTGCAG No data
Right 1134254722 16:12601605-12601627 CAAGTGCAGCCTGCTTAGCCAGG No data
1134254720_1134254725 13 Left 1134254720 16:12601591-12601613 CCAGTGGCATGAGCCAAGTGCAG No data
Right 1134254725 16:12601627-12601649 GTGAGCACAATGAGCCCAGCAGG No data
1134254720_1134254728 30 Left 1134254720 16:12601591-12601613 CCAGTGGCATGAGCCAAGTGCAG No data
Right 1134254728 16:12601644-12601666 AGCAGGTGTGAGCAATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134254720 Original CRISPR CTGCACTTGGCTCATGCCAC TGG (reversed) Intergenic
No off target data available for this crispr