ID: 1134254723

View in Genome Browser
Species Human (GRCh38)
Location 16:12601614-12601636
Sequence TTGTGCTCACCTGGCTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134254723_1134254730 30 Left 1134254723 16:12601614-12601636 CCTGCTTAGCCAGGTGAGCACAA No data
Right 1134254730 16:12601667-12601689 CAGAAGGTCCCACTGACCACAGG No data
1134254723_1134254728 7 Left 1134254723 16:12601614-12601636 CCTGCTTAGCCAGGTGAGCACAA No data
Right 1134254728 16:12601644-12601666 AGCAGGTGTGAGCAATGCTCAGG No data
1134254723_1134254725 -10 Left 1134254723 16:12601614-12601636 CCTGCTTAGCCAGGTGAGCACAA No data
Right 1134254725 16:12601627-12601649 GTGAGCACAATGAGCCCAGCAGG No data
1134254723_1134254729 14 Left 1134254723 16:12601614-12601636 CCTGCTTAGCCAGGTGAGCACAA No data
Right 1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134254723 Original CRISPR TTGTGCTCACCTGGCTAAGC AGG (reversed) Intergenic
No off target data available for this crispr