ID: 1134254724

View in Genome Browser
Species Human (GRCh38)
Location 16:12601623-12601645
Sequence CTGGGCTCATTGTGCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134254724_1134254732 23 Left 1134254724 16:12601623-12601645 CCAGGTGAGCACAATGAGCCCAG No data
Right 1134254732 16:12601669-12601691 GAAGGTCCCACTGACCACAGGGG No data
1134254724_1134254730 21 Left 1134254724 16:12601623-12601645 CCAGGTGAGCACAATGAGCCCAG No data
Right 1134254730 16:12601667-12601689 CAGAAGGTCCCACTGACCACAGG No data
1134254724_1134254729 5 Left 1134254724 16:12601623-12601645 CCAGGTGAGCACAATGAGCCCAG No data
Right 1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG No data
1134254724_1134254728 -2 Left 1134254724 16:12601623-12601645 CCAGGTGAGCACAATGAGCCCAG No data
Right 1134254728 16:12601644-12601666 AGCAGGTGTGAGCAATGCTCAGG No data
1134254724_1134254731 22 Left 1134254724 16:12601623-12601645 CCAGGTGAGCACAATGAGCCCAG No data
Right 1134254731 16:12601668-12601690 AGAAGGTCCCACTGACCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134254724 Original CRISPR CTGGGCTCATTGTGCTCACC TGG (reversed) Intergenic
No off target data available for this crispr