ID: 1134254728

View in Genome Browser
Species Human (GRCh38)
Location 16:12601644-12601666
Sequence AGCAGGTGTGAGCAATGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134254720_1134254728 30 Left 1134254720 16:12601591-12601613 CCAGTGGCATGAGCCAAGTGCAG No data
Right 1134254728 16:12601644-12601666 AGCAGGTGTGAGCAATGCTCAGG No data
1134254723_1134254728 7 Left 1134254723 16:12601614-12601636 CCTGCTTAGCCAGGTGAGCACAA No data
Right 1134254728 16:12601644-12601666 AGCAGGTGTGAGCAATGCTCAGG No data
1134254721_1134254728 17 Left 1134254721 16:12601604-12601626 CCAAGTGCAGCCTGCTTAGCCAG No data
Right 1134254728 16:12601644-12601666 AGCAGGTGTGAGCAATGCTCAGG No data
1134254724_1134254728 -2 Left 1134254724 16:12601623-12601645 CCAGGTGAGCACAATGAGCCCAG No data
Right 1134254728 16:12601644-12601666 AGCAGGTGTGAGCAATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134254728 Original CRISPR AGCAGGTGTGAGCAATGCTC AGG Intergenic
No off target data available for this crispr