ID: 1134254913

View in Genome Browser
Species Human (GRCh38)
Location 16:12602903-12602925
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134254912_1134254913 16 Left 1134254912 16:12602864-12602886 CCACTACTCTGTTGCTGTGGGGT No data
Right 1134254913 16:12602903-12602925 AGCAACGCAAGCAGCCCCGACGG No data
1134254906_1134254913 30 Left 1134254906 16:12602850-12602872 CCTTCCATAAAAGCCCACTACTC No data
Right 1134254913 16:12602903-12602925 AGCAACGCAAGCAGCCCCGACGG No data
1134254910_1134254913 17 Left 1134254910 16:12602863-12602885 CCCACTACTCTGTTGCTGTGGGG No data
Right 1134254913 16:12602903-12602925 AGCAACGCAAGCAGCCCCGACGG No data
1134254907_1134254913 26 Left 1134254907 16:12602854-12602876 CCATAAAAGCCCACTACTCTGTT No data
Right 1134254913 16:12602903-12602925 AGCAACGCAAGCAGCCCCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134254913 Original CRISPR AGCAACGCAAGCAGCCCCGA CGG Intergenic