ID: 1134254928

View in Genome Browser
Species Human (GRCh38)
Location 16:12602964-12602986
Sequence CCAGCCCAGGGCTCCCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134254917_1134254928 23 Left 1134254917 16:12602918-12602940 CCCGACGGGAGGCTCCTGCAACA No data
Right 1134254928 16:12602964-12602986 CCAGCCCAGGGCTCCCATGTAGG No data
1134254922_1134254928 -1 Left 1134254922 16:12602942-12602964 CCATGCAGGCGGTTCCAGAAGCC No data
Right 1134254928 16:12602964-12602986 CCAGCCCAGGGCTCCCATGTAGG No data
1134254921_1134254928 9 Left 1134254921 16:12602932-12602954 CCTGCAACATCCATGCAGGCGGT No data
Right 1134254928 16:12602964-12602986 CCAGCCCAGGGCTCCCATGTAGG No data
1134254918_1134254928 22 Left 1134254918 16:12602919-12602941 CCGACGGGAGGCTCCTGCAACAT No data
Right 1134254928 16:12602964-12602986 CCAGCCCAGGGCTCCCATGTAGG No data
1134254916_1134254928 24 Left 1134254916 16:12602917-12602939 CCCCGACGGGAGGCTCCTGCAAC No data
Right 1134254928 16:12602964-12602986 CCAGCCCAGGGCTCCCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134254928 Original CRISPR CCAGCCCAGGGCTCCCATGT AGG Intergenic
No off target data available for this crispr