ID: 1134262934

View in Genome Browser
Species Human (GRCh38)
Location 16:12667455-12667477
Sequence CTGGCCTATCTCATTTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134262934_1134262942 23 Left 1134262934 16:12667455-12667477 CCTCAATAAATGAGATAGGCCAG 0: 1
1: 0
2: 1
3: 2
4: 163
Right 1134262942 16:12667501-12667523 CCCTGTACTTTGAGAGGCTGAGG 0: 2
1: 234
2: 7592
3: 106644
4: 229573
1134262934_1134262940 17 Left 1134262934 16:12667455-12667477 CCTCAATAAATGAGATAGGCCAG 0: 1
1: 0
2: 1
3: 2
4: 163
Right 1134262940 16:12667495-12667517 TGTAATCCCTGTACTTTGAGAGG 0: 4
1: 608
2: 23199
3: 330373
4: 265700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134262934 Original CRISPR CTGGCCTATCTCATTTATTG AGG (reversed) Intronic
904123468 1:28218993-28219015 CTGTTCTTTCTCATTTATTTGGG - Intronic
911764004 1:101652334-101652356 ATGGCTTATCTCTTATATTGTGG + Intergenic
911825056 1:102472697-102472719 CTGGGCTGTCTCATATGTTGAGG + Intergenic
914413511 1:147455483-147455505 CTGGCTAATCTAATTTCTTGTGG - Intergenic
916269886 1:162929172-162929194 CTGGATTATTTCATTTCTTGAGG + Intergenic
916292077 1:163177932-163177954 CTGGCGTATCTCAGTGATTTTGG - Intronic
919734788 1:200940060-200940082 ATAGCGTATCTCATTTATTTAGG + Intergenic
920544869 1:206808032-206808054 CTGGCCTATATCAATTTTTATGG - Intronic
922972228 1:229752340-229752362 ATGGCCTATCTAATTTATGATGG + Intergenic
924066092 1:240223493-240223515 CTGCCCTAACTCATTTTGTGAGG - Intronic
1064076703 10:12274612-12274634 CCGGCCTATGTTATTTTTTGAGG + Intergenic
1064556905 10:16556036-16556058 ATGGTGTATCACATTTATTGTGG + Intergenic
1064870629 10:19933255-19933277 TTGGCCTAGATCATTTACTGTGG + Intronic
1065996042 10:31060333-31060355 CTGGCCTCTCTCTTTAATTGAGG - Intergenic
1066453759 10:35554540-35554562 CTGGCCTGTTTTCTTTATTGGGG + Intronic
1066600294 10:37098236-37098258 CTGGGCTATCTCATTGTTTCAGG + Intergenic
1068130935 10:52894332-52894354 CTGGCCATTCTCATTTTTGGTGG + Intergenic
1071291217 10:84190669-84190691 CTTGCCTATCTCTTTAACTGAGG - Intergenic
1071331851 10:84568428-84568450 CTGGCCCATCTATTTTTTTGAGG + Intergenic
1072375033 10:94805839-94805861 TTGGCCTATCACATTCTTTGAGG + Intronic
1072485817 10:95853941-95853963 CTGCCCTAACTCATTTTATGAGG - Intronic
1075018111 10:118926066-118926088 ATTGACTCTCTCATTTATTGTGG + Intergenic
1076092249 10:127697128-127697150 CTGGCCTATTTTCATTATTGGGG + Intergenic
1078300390 11:10124712-10124734 CTGGGCTTTCTCATTAACTGAGG + Intronic
1079390199 11:20015554-20015576 ATGGCATATCTCATGGATTGCGG + Intronic
1079688854 11:23397461-23397483 CTGGCTTATTTCACTTACTGTGG - Intergenic
1081653375 11:44840308-44840330 CTGGCCTCTCTCCCTCATTGGGG + Intronic
1087182039 11:95150860-95150882 CTGGCCTCTCTCATCTTTGGTGG + Intergenic
1091632152 12:2170403-2170425 CTGGCCTCTCTCTTTTCTTTAGG - Intronic
1091832641 12:3560846-3560868 CTGGCCTATCTCCTCTAAAGGGG - Intronic
1093610157 12:21145956-21145978 ACTTCCTATCTCATTTATTGAGG - Intronic
1093717822 12:22403721-22403743 CTGCCCTAACTCATTTTATGAGG + Intronic
1096451933 12:51750248-51750270 CTGGTGTATTTCATGTATTGGGG + Intronic
1097846323 12:64370352-64370374 CCGGCCTATCTTTTTTTTTGGGG - Intronic
1099092020 12:78323937-78323959 CTGGCCTATTTCTTTAAGTGTGG + Intergenic
1100055996 12:90510371-90510393 CTTCCCTATCTCATTTTATGAGG - Intergenic
1104088825 12:125497383-125497405 CAGGCCGATTTCATTTAGTGTGG + Intronic
1104300986 12:127564913-127564935 CTGGCCTACCTCCCTTAGTGTGG - Intergenic
1104958151 12:132475825-132475847 CTGGCCTGTGTCGTTTGTTGTGG - Intergenic
1104982391 12:132579346-132579368 ATGGTGTATCTCATTTATTTAGG + Intronic
1106073993 13:26441634-26441656 CTTCCCTTTCCCATTTATTGAGG - Intergenic
1106649011 13:31668813-31668835 TTGGCTTATTTCATTTAATGTGG + Intergenic
1110736034 13:78937817-78937839 CTTGCATATCTCAGTTATTCTGG - Intergenic
1112717995 13:102208893-102208915 CGAGCCTATTTCATATATTGTGG - Intronic
1114489105 14:23085764-23085786 CTGGCCTAAGACATTCATTGTGG - Intronic
1115182597 14:30646628-30646650 CTTCCCTATCTCATTCAATGAGG - Intronic
1115502723 14:34063794-34063816 CTGGCCTCTCTCAGGTACTGGGG - Intronic
1116752067 14:48899162-48899184 CTGGTCAATCTCATGAATTGGGG + Intergenic
1119258073 14:73217016-73217038 CTGACTTCTCTCATTCATTGTGG + Intronic
1120691689 14:87600033-87600055 CTTGGCTATCTCATTTTTTTTGG - Intergenic
1125053641 15:35331803-35331825 CTGTCCTGTCTCCATTATTGAGG + Intronic
1126391600 15:48161428-48161450 CTGGGATATCTAATTTATAGAGG - Intronic
1127745926 15:61972375-61972397 GTGGCATATCTAATTTATTCTGG - Intronic
1131805917 15:96122382-96122404 CAGGTCTATCTTATTTACTGAGG - Intergenic
1132916039 16:2344728-2344750 ATGGACTATCTCAATTATTCAGG + Intergenic
1134251736 16:12578815-12578837 CAGGCCTATCTCATTGTTTCTGG - Intergenic
1134262934 16:12667455-12667477 CTGGCCTATCTCATTTATTGAGG - Intronic
1134355165 16:13475651-13475673 CAAGCATATCACATTTATTGCGG + Intergenic
1135557772 16:23451415-23451437 CTGGCCTAAACCATTTGTTGAGG - Intronic
1135886854 16:26317989-26318011 CTGGCCTATCTCTCTCATTGTGG + Intergenic
1137959663 16:52869566-52869588 CTGGCCTGGATCATTGATTGAGG - Intergenic
1138025097 16:53515972-53515994 ATGACCTGTCTCATTTATTCAGG + Intergenic
1138377258 16:56573380-56573402 CTGGCCTATTTAATTTCTTAAGG - Intergenic
1139840953 16:69879490-69879512 CTGGCTTATTTCACTTAATGTGG + Intronic
1144176812 17:12715376-12715398 CTGTCCTCTCTCATTGCTTGTGG + Intronic
1147283753 17:39384229-39384251 CTGGCCTATTTATTTTTTTGAGG - Intronic
1149302702 17:55319352-55319374 CTGGCCTGACCCATTTATTCTGG + Intronic
1153488302 18:5624289-5624311 CTGGCCTCGCTCATGTATTTAGG + Intronic
1156738704 18:40297332-40297354 CTGCTCTATGGCATTTATTGAGG - Intergenic
1157062086 18:44303480-44303502 CTTGCCTAACTCATTTTATGAGG + Intergenic
1157111626 18:44826206-44826228 GTTGCCTTTCTCATTCATTGGGG + Intronic
1158255186 18:55538335-55538357 CTAGACTTTCTCATTGATTGGGG + Intronic
1158325342 18:56307852-56307874 CTGGCCCTTCTCATTTGTTAGGG + Intergenic
1159943795 18:74428745-74428767 CTGGTCCATCTCATGTATTAAGG + Intergenic
1164367254 19:27599240-27599262 CCGGCCTAACTCATTTTATGAGG + Intergenic
1165019284 19:32909962-32909984 CTGGCCTATCTCATCAATCTAGG - Intronic
927730825 2:25470085-25470107 CTGGCCTTGTGCATTTATTGTGG - Intronic
929381745 2:41362081-41362103 CTGCCCTAACTCATTTTATGAGG + Intergenic
929706501 2:44217921-44217943 CTGGCTTATCACATTAATTTAGG + Intronic
935130885 2:100260061-100260083 CTGGCATATATCACTTATAGTGG + Intergenic
936344582 2:111665619-111665641 CTGGCCTATCTCATCTTTGCAGG - Intergenic
940401567 2:153253977-153253999 CTGTCCTAACTCATTTTATGAGG - Intergenic
941265340 2:163354626-163354648 CTGGAATATCTCAATTATTTAGG + Intergenic
942392189 2:175507095-175507117 CCTGCCTAACTCATTTAATGAGG + Intergenic
944354548 2:198770820-198770842 CTGGGGTATGTCATTTTTTGAGG - Intergenic
945360522 2:208890860-208890882 CTGGCCTGGCTTATTTCTTGTGG - Intergenic
945945553 2:215992028-215992050 CTGCCCTAACTCATTTTATGAGG + Intronic
1170506256 20:17028764-17028786 CTGTCCTAACTCATTTTCTGTGG - Intergenic
1173047766 20:39528830-39528852 CTGGTCTTGCTCATTTCTTGTGG - Intergenic
1174465323 20:50712847-50712869 CTGCCCTCTGTCATTTACTGTGG + Intergenic
1177688440 21:24470953-24470975 CTGGGCTAGTTCCTTTATTGAGG + Intergenic
1179346597 21:40564106-40564128 CTGACCAAGCACATTTATTGTGG - Intronic
1183889872 22:40918373-40918395 CTGGCCTAACTTTTTTATTTTGG - Intronic
1184604551 22:45564721-45564743 CAGGTCTATCTCATTCAGTGCGG + Intronic
949288216 3:2431226-2431248 CTGGCCTATCTTATTTTTAATGG - Intronic
950337501 3:12208905-12208927 ATGGCCTATACCATTTATTTGGG + Intergenic
952461588 3:33532245-33532267 CTGGCTTATTTCATTTAGCGTGG - Intronic
954318014 3:49811822-49811844 CCAGCCTCTGTCATTTATTGGGG - Intronic
956387166 3:68731921-68731943 CTGTCCTTTCACATTTATAGGGG - Exonic
959706597 3:109343783-109343805 CTGGCCCTTATCATTTATTTGGG + Intergenic
961989225 3:131169577-131169599 CTGGCCTGTCTTATGTATTATGG - Intronic
962976418 3:140449989-140450011 CTGGCCTGCCTCCTTTCTTGTGG - Intronic
964372393 3:156014149-156014171 CTGGCTTATCTCATTTAACATGG - Intergenic
964500541 3:157343659-157343681 CTGCCCTAACTCATTTTATGAGG + Intronic
964650181 3:159002950-159002972 CTGACCCATGTCATTTATGGGGG + Intronic
964712873 3:159690105-159690127 CTTCCCTAACTCATTTTTTGAGG - Intronic
970999962 4:22310912-22310934 CTGTCCTCTCTCATTTTTTCAGG - Intergenic
974561732 4:63531904-63531926 TTTGCCTATATCATTTATGGAGG - Intergenic
974634287 4:64539181-64539203 CTGTCCTTTCTCTTTTATTATGG - Intergenic
977431662 4:96938130-96938152 CTGGCCTATCTGGTCTAGTGAGG - Intergenic
977500583 4:97832001-97832023 CCTCCCTAACTCATTTATTGAGG + Intronic
978453133 4:108858787-108858809 CTGGCGTATCACCTTTATTTTGG - Intronic
979187093 4:117810687-117810709 CTGGCCTGTGAAATTTATTGGGG + Intergenic
979667938 4:123333164-123333186 CTGCCCTAACTCATTTTATGTGG - Intergenic
982842613 4:160210598-160210620 CTGGCCTAGGGCATTTATGGTGG - Intergenic
983124342 4:163931830-163931852 CTGGCCTACCTCATCAATTTTGG + Intronic
990203018 5:53398964-53398986 CTTCTCTATCTCATTTAATGTGG + Intergenic
990644054 5:57823356-57823378 CTGGGCTATCGTATTTATTTTGG - Intergenic
990705058 5:58518873-58518895 CTTCCCTAACTCATTTAATGAGG + Intergenic
991953424 5:71969173-71969195 CTGACATGTCTCATCTATTGGGG + Intergenic
994383466 5:99099612-99099634 CTGGGTTATCTCATGTATTCAGG + Intergenic
994658706 5:102627153-102627175 CTTGGCTATCTCATTCCTTGGGG + Intergenic
1004599930 6:17139429-17139451 CTTGCCTATGTTATTTATAGCGG + Intergenic
1004882405 6:20022106-20022128 CTGAGCTATCACATTTATAGTGG + Intergenic
1005215928 6:23527929-23527951 CTGGCTTATTTCACTTATTTAGG - Intergenic
1008253098 6:49264908-49264930 CTGGCATATCTCAGTTTTTTGGG - Intergenic
1009218219 6:60948423-60948445 CTGGCTGATCTCATTTTTTATGG + Intergenic
1009722956 6:67498640-67498662 CTGGCCTATGTCAATTATATTGG + Intergenic
1010493694 6:76505739-76505761 CTTCCCTATCTCATTTTATGAGG - Intergenic
1015232384 6:130930297-130930319 CTTTCCTACCTCATTTAGTGAGG - Intronic
1016354798 6:143206848-143206870 CTGGCCTAGCTCATTTAAGTTGG - Intronic
1016700038 6:147044036-147044058 ATTGCCTATCCCAATTATTGGGG + Intergenic
1017188310 6:151624959-151624981 CTGCCCTATCAGAATTATTGTGG - Intergenic
1017671284 6:156771879-156771901 CTGGCCACTCTCATTTATTGCGG - Intergenic
1017679992 6:156853895-156853917 CTGGCTAATTTCATTTTTTGTGG + Intronic
1020400316 7:7769596-7769618 CAGGCCAATCAAATTTATTGTGG + Intronic
1023995214 7:45155648-45155670 ATGGTCAATCTCATTTATGGCGG + Intergenic
1029258944 7:99288275-99288297 CTGGCTAATTTCATTTTTTGAGG - Intergenic
1029337225 7:99912232-99912254 CTGGCCTATGGTATTTTTTGAGG - Intronic
1031802739 7:126269697-126269719 CTGTACTGTCTCATGTATTGTGG + Intergenic
1033525960 7:142213797-142213819 CTGCCCTAACTCATTTTATGAGG + Intronic
1039084611 8:33767402-33767424 TTGGCCTATCCCCTTTCTTGTGG + Intergenic
1040761168 8:50845961-50845983 CTGGCAACTGTCATTTATTGAGG - Intergenic
1040852680 8:51917644-51917666 CTAGGTTATCTAATTTATTGGGG + Intergenic
1042987787 8:74603441-74603463 CTGACGGATCTCATTTATTTTGG + Intronic
1043340178 8:79229020-79229042 CTGACCTAGTGCATTTATTGTGG - Intergenic
1045297552 8:100885307-100885329 CAGGCCTACCTGATTTAATGGGG - Intergenic
1046304394 8:112344544-112344566 CTGTACTATGTCACTTATTGAGG - Intronic
1051080308 9:13286376-13286398 CTGCCATAGTTCATTTATTGAGG + Intergenic
1055377503 9:75665598-75665620 CAGGGCTCTCTCATTTGTTGAGG - Intergenic
1055567424 9:77583159-77583181 CTGCGTTATCTCATTTGTTGGGG - Intronic
1056265773 9:84895505-84895527 CTGGCCTCTCTTCTTAATTGTGG - Intronic
1057559261 9:96114548-96114570 CTGGCTAATTTCTTTTATTGTGG + Intronic
1057574294 9:96229350-96229372 CTGGCATCTCTCATTGATAGAGG - Intergenic
1058190828 9:101912874-101912896 CTGATCTCTCTCATTTAATGAGG + Intergenic
1059993650 9:119888855-119888877 TCGGCCTATTTCATTGATTGTGG + Intergenic
1060432334 9:123561179-123561201 CTGGCCTTTCTCTTTCATTCGGG + Intronic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1186447436 X:9643552-9643574 CTGGCCTATATCAATTTTGGAGG - Intronic
1187391753 X:18890768-18890790 CTGGCCTTTTGCATTTTTTGTGG + Intergenic
1187784662 X:22870317-22870339 CTGCCCTAACTCATTTTATGAGG + Intergenic
1191966418 X:66763593-66763615 CTGCCCTAACTCATTTTCTGAGG - Intergenic
1192555072 X:72082707-72082729 CTGGCCTCTCTCATTTCCTTGGG + Intergenic
1192599539 X:72447071-72447093 CTGCCCTAACTCATTTTATGAGG + Intronic
1192894609 X:75428588-75428610 CTGACCTATCTCACATAATGGGG - Intronic
1193505977 X:82345516-82345538 CTTGACTGACTCATTTATTGGGG + Intergenic
1201312484 Y:12609501-12609523 CTGGCCTATTTTATTTTTTCTGG - Intergenic