ID: 1134263750

View in Genome Browser
Species Human (GRCh38)
Location 16:12674923-12674945
Sequence CTGGAGAAAGCCTCCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134263750_1134263765 9 Left 1134263750 16:12674923-12674945 CCCACCCAGGAGGCTTTCTCCAG No data
Right 1134263765 16:12674955-12674977 AGCTTCTCACTGCTGGAGGGGGG No data
1134263750_1134263764 8 Left 1134263750 16:12674923-12674945 CCCACCCAGGAGGCTTTCTCCAG No data
Right 1134263764 16:12674954-12674976 CAGCTTCTCACTGCTGGAGGGGG No data
1134263750_1134263761 6 Left 1134263750 16:12674923-12674945 CCCACCCAGGAGGCTTTCTCCAG No data
Right 1134263761 16:12674952-12674974 GCCAGCTTCTCACTGCTGGAGGG No data
1134263750_1134263759 2 Left 1134263750 16:12674923-12674945 CCCACCCAGGAGGCTTTCTCCAG No data
Right 1134263759 16:12674948-12674970 CAGGGCCAGCTTCTCACTGCTGG No data
1134263750_1134263760 5 Left 1134263750 16:12674923-12674945 CCCACCCAGGAGGCTTTCTCCAG No data
Right 1134263760 16:12674951-12674973 GGCCAGCTTCTCACTGCTGGAGG No data
1134263750_1134263766 21 Left 1134263750 16:12674923-12674945 CCCACCCAGGAGGCTTTCTCCAG No data
Right 1134263766 16:12674967-12674989 CTGGAGGGGGGCACACAGCATGG No data
1134263750_1134263763 7 Left 1134263750 16:12674923-12674945 CCCACCCAGGAGGCTTTCTCCAG No data
Right 1134263763 16:12674953-12674975 CCAGCTTCTCACTGCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134263750 Original CRISPR CTGGAGAAAGCCTCCTGGGT GGG (reversed) Intronic
No off target data available for this crispr