ID: 1134264382

View in Genome Browser
Species Human (GRCh38)
Location 16:12680823-12680845
Sequence GCTGAACCCTGCTGGAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134264379_1134264382 -9 Left 1134264379 16:12680809-12680831 CCACGTGCTCCTGGGCTGAACCC No data
Right 1134264382 16:12680823-12680845 GCTGAACCCTGCTGGAAACCTGG No data
1134264374_1134264382 18 Left 1134264374 16:12680782-12680804 CCTCTCAAAGGTTTCACTGTGAT No data
Right 1134264382 16:12680823-12680845 GCTGAACCCTGCTGGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134264382 Original CRISPR GCTGAACCCTGCTGGAAACC TGG Intronic
No off target data available for this crispr