ID: 1134264383

View in Genome Browser
Species Human (GRCh38)
Location 16:12680824-12680846
Sequence CTGAACCCTGCTGGAAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134264379_1134264383 -8 Left 1134264379 16:12680809-12680831 CCACGTGCTCCTGGGCTGAACCC No data
Right 1134264383 16:12680824-12680846 CTGAACCCTGCTGGAAACCTGGG No data
1134264374_1134264383 19 Left 1134264374 16:12680782-12680804 CCTCTCAAAGGTTTCACTGTGAT No data
Right 1134264383 16:12680824-12680846 CTGAACCCTGCTGGAAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134264383 Original CRISPR CTGAACCCTGCTGGAAACCT GGG Intronic
No off target data available for this crispr