ID: 1134264695

View in Genome Browser
Species Human (GRCh38)
Location 16:12683178-12683200
Sequence TGAGATTCCGTTTGAATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134264691_1134264695 5 Left 1134264691 16:12683150-12683172 CCATCAAAACGTAAGGACCTTGG No data
Right 1134264695 16:12683178-12683200 TGAGATTCCGTTTGAATAACTGG 0: 1
1: 0
2: 0
3: 7
4: 104
1134264689_1134264695 25 Left 1134264689 16:12683130-12683152 CCAAGAAGGGGGTACTGCATCCA No data
Right 1134264695 16:12683178-12683200 TGAGATTCCGTTTGAATAACTGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134264695 Original CRISPR TGAGATTCCGTTTGAATAAC TGG Intronic
902177262 1:14660024-14660046 TTTAATTCCGTTTTAATAACAGG - Intronic
904222962 1:28988247-28988269 TGAGATTCCGTCTCAACAACGGG + Intronic
905317178 1:37090220-37090242 TGAGAGTCCATTTGAATCAGTGG - Intergenic
907844481 1:58191390-58191412 TGGGATTCCGATTGAAAAAAAGG - Intronic
908672306 1:66561792-66561814 TAATATTCCATTTGAATAAAAGG - Intronic
917997771 1:180459172-180459194 AGAGATTTCTTTTGAATAACGGG - Intronic
918747788 1:188228213-188228235 TCACATTCCTTTTGAATACCTGG - Intergenic
923027454 1:230217318-230217340 GGAGTGTGCGTTTGAATAACTGG + Intronic
923548673 1:234943787-234943809 TGGCATTCCCTTTGAATAGCTGG - Intergenic
923960019 1:239069963-239069985 TGAGATCCTGCTGGAATAACAGG - Intergenic
1065074922 10:22067806-22067828 TGAGATTCCATATGAATATTAGG + Intergenic
1067021504 10:42803577-42803599 TGAGACACGGTTTTAATAACTGG - Intronic
1067282512 10:44883143-44883165 TGAGCTGCCCTTTGAATGACAGG - Intergenic
1068861012 10:61848054-61848076 TGAGAGTCCCATTGAATAAAAGG + Intergenic
1069011275 10:63375941-63375963 TGAGATTCTGTATGAATTTCAGG - Intronic
1072172867 10:92883627-92883649 TGATATGCCATTTGAAGAACTGG + Intronic
1072246145 10:93545764-93545786 TGAGATTCCATCTCAAAAACAGG + Intergenic
1072645957 10:97254179-97254201 TGAGATTCCGTATGAATTTTAGG - Intronic
1075307390 10:121380202-121380224 TGAGATTCTGCTTGTCTAACAGG - Intergenic
1076077818 10:127550573-127550595 TGACATTTCTGTTGAATAACAGG + Intronic
1076750712 10:132541336-132541358 TGAGATTCCGTGTGGATCCCAGG - Intronic
1078631195 11:13006249-13006271 TGAGATTCCTCTTAAACAACTGG - Intergenic
1084850255 11:71933504-71933526 TGAAATTTTGTTTGAATAAAAGG - Intronic
1091605598 12:1948973-1948995 TTAGCTTCCGTGAGAATAACAGG - Intronic
1095492602 12:42750075-42750097 ACAGATTCCCTTTGAATAAGTGG - Intergenic
1099329596 12:81266920-81266942 TCAGATCTCTTTTGAATAACAGG + Intronic
1100483940 12:95006547-95006569 TGAGATTCCGTATGAATTTTAGG + Intergenic
1101515082 12:105427284-105427306 TGAGATTTTGCTTGAATATCTGG - Intergenic
1103745446 12:123120010-123120032 TGAGTTTCCCTTTGACTCACTGG - Intronic
1105494028 13:20914641-20914663 TGAGATTCCATATGAATGACAGG - Intergenic
1109290693 13:60471499-60471521 TGAGATTCCTTATGAATTATAGG + Intronic
1110540919 13:76706079-76706101 TGAGTGTCCCTTTCAATAACTGG - Intergenic
1112500177 13:99936898-99936920 TGAGATTCAAATTGAATGACGGG - Intergenic
1115561773 14:34589127-34589149 TGAGATTCTGTATCAATAAAAGG + Intronic
1116562374 14:46397072-46397094 TGAAATTGAGTTTTAATAACTGG + Intergenic
1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG + Intronic
1118551350 14:66954126-66954148 TGAGATTCCATATGAATTTCAGG + Intronic
1127683631 15:61320689-61320711 TGTGATTCCGTTTGATAGACGGG + Intergenic
1133379560 16:5318709-5318731 TAAGTTACCGTTTGGATAACTGG - Intergenic
1134264695 16:12683178-12683200 TGAGATTCCGTTTGAATAACTGG + Intronic
1141467768 16:84218099-84218121 TGAGAATCCGATGGAATCACTGG + Intergenic
1145235216 17:21203091-21203113 CGAGATTCCCTTTGCCTAACTGG - Intronic
1148906132 17:50913404-50913426 TGAGATTGCCTTGGAAAAACAGG - Intergenic
1149238222 17:54617913-54617935 TGAGATTCTGATAGAATAAAAGG + Intergenic
1155013720 18:21810391-21810413 TGAGATTCCTTATGAATTTCTGG - Intronic
1157479556 18:48044693-48044715 TCAGATTCCATTTATATAACAGG + Intronic
1161555135 19:4937139-4937161 TGTGATTCCATTTATATAACGGG - Intronic
1166272551 19:41724456-41724478 TGAGATTCCATATGAATTTCAGG + Intronic
1167187926 19:47960620-47960642 TGAGATTCCGTATGAATTTTAGG - Intergenic
925317607 2:2937836-2937858 TGAGATTCTGTTTCAAAAAAAGG - Intergenic
928589180 2:32796650-32796672 TGAGATTCCATTTGAATTTTAGG - Intronic
930033449 2:47071840-47071862 TGGGATTCTGTTTGAAAAATGGG - Intronic
935403069 2:102680776-102680798 GGAGATTCCATTAGAATATCTGG + Intronic
937899672 2:127009498-127009520 TGAGATTCCATATGAATTTCAGG + Intergenic
940344296 2:152613389-152613411 TGAGATTCACAATGAATAACAGG - Intronic
944057627 2:195539935-195539957 TGAGATTACATTTGAATCAGCGG + Intergenic
944874941 2:203953422-203953444 TGAGAATTAGTTTGAATAATAGG + Intronic
1171221906 20:23405842-23405864 TGAGATTCCATTTATATGACAGG + Intronic
1182990002 22:34758421-34758443 TGGGATTCATTTTGAAGAACTGG + Intergenic
954071921 3:48149311-48149333 TGAGATTCCGTATGGAAAAAAGG - Intergenic
954470796 3:50693215-50693237 TGAGATTCCATATGAATTTCAGG + Intronic
957283353 3:78182907-78182929 TAAGGTTCTGTTTGAATTACAGG + Intergenic
962921710 3:139956113-139956135 TGAGACTCAGTTTCCATAACTGG - Intronic
963594293 3:147305278-147305300 TGAAATCCTGTTTGAATAATAGG - Intergenic
966588724 3:181655713-181655735 TGAGTTTTCCTTTGAATAATTGG + Intergenic
968670802 4:1850274-1850296 TGAGATACTGTTTTCATAACTGG - Intronic
969684393 4:8662386-8662408 TGAGACTCCGTCTCAAAAACAGG + Intergenic
970720542 4:18983571-18983593 TCAGATTGCTTGTGAATAACGGG - Intergenic
971765936 4:30831746-30831768 TGAGATTCTGTTTCAGTAGCTGG - Intronic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
979975775 4:127194613-127194635 TGAGATTGCATTTGAAGAAGAGG - Intergenic
980533559 4:134086541-134086563 TGAGATTTCTTTTGAAAAAGAGG - Intergenic
985485873 5:148725-148747 TGAGATTCCCTATGAATTTCAGG - Intronic
988280416 5:29138978-29139000 TGAGACTCTGTTTCAAAAACAGG - Intergenic
994202515 5:96994238-96994260 TGAGACTCAGTTTAAATAAATGG + Intronic
995606875 5:113866436-113866458 TGAGATTTCATTTGAACAAAGGG - Intergenic
998606792 5:143643618-143643640 TGAGATTCCGCATTTATAACAGG - Intergenic
1002864279 6:1107542-1107564 TGAGATTCGGGGTGAAGAACAGG - Intergenic
1008105893 6:47440747-47440769 TGTGACTTTGTTTGAATAACAGG - Intergenic
1008442413 6:51547537-51547559 TGAGATAACGTTTAAATCACAGG - Intergenic
1012029990 6:94047183-94047205 TGATATTCCTTTTCAATAAGTGG - Intergenic
1014538570 6:122647350-122647372 TGAGTGTCCGATTGATTAACTGG + Intronic
1014814692 6:125922582-125922604 TGATACTGAGTTTGAATAACAGG + Intronic
1015220611 6:130801319-130801341 TGAGATTCCATATGAATTATAGG + Intergenic
1016099946 6:140086842-140086864 TGGGCTTCCCTTTGATTAACAGG + Intergenic
1016345954 6:143114090-143114112 TGAAATTCTGTTTGTTTAACAGG - Intronic
1016799471 6:148154254-148154276 TCAGATTCTGTTTGATTACCTGG + Intergenic
1020458715 7:8403762-8403784 TAAGATTACCTTTGAATAAATGG - Intergenic
1020821957 7:12981263-12981285 TTAGATTTAGTTTGAATAACTGG - Intergenic
1028203290 7:87987649-87987671 AAAGATTCCATTTGAATAATTGG + Intronic
1028679653 7:93510913-93510935 TGAGATTCTATTTGAAGAATGGG + Intronic
1029130214 7:98324210-98324232 TGTGATTCAGTCTGAATAAGTGG + Intronic
1029404112 7:100363678-100363700 TCAGATTCCATTTGAATTTCAGG - Intronic
1031211231 7:118829264-118829286 TGATATTACATTTGATTAACTGG - Intergenic
1031273951 7:119693981-119694003 TGAGATTAGATTTGAATCACTGG - Intergenic
1032605810 7:133350677-133350699 TGAGATTCTGTATGAATTTCAGG + Intronic
1035043456 7:155947825-155947847 TGAAATTGAGTTTGAATATCAGG + Intergenic
1037284481 8:17283816-17283838 TGAGATTCCGTATGAATTTTAGG + Intronic
1043401288 8:79887191-79887213 TGAGATTCCATTTGCTGAACTGG - Intergenic
1044116335 8:88340004-88340026 TGAGATACCGTCCGAATTACAGG + Intergenic
1045377336 8:101587332-101587354 TGAGAGTCTGTTTTAATGACAGG + Intronic
1050398054 9:5220929-5220951 TGAGATTCCATATGAATATTAGG - Intergenic
1051031028 9:12678637-12678659 AGAGATTCTGTTTGATTTACTGG - Intergenic
1051132997 9:13883562-13883584 TGAGATTCCATTTGAAAAGAAGG - Intergenic
1051145008 9:14017681-14017703 TGAAATTTCATTTGAATAAAGGG + Intergenic
1051368445 9:16337958-16337980 TGAGATTCCTTTGAAATAACAGG + Intergenic
1059806940 9:117811724-117811746 TGAGATTCCTTTTGAGTAGCAGG + Intergenic
1194147210 X:90279427-90279449 TAAGATTGCGTTTGAAAAAGGGG + Intergenic
1194600727 X:95918601-95918623 TGACATTGCTTTTGAATAATTGG - Intergenic
1195017803 X:100796091-100796113 TGACATTCCATTGGAATAATGGG - Intergenic
1196051628 X:111312000-111312022 TGAGAATCTGTTTGGATAGCGGG + Intronic
1196148215 X:112343096-112343118 TGAGATTCCGTCTCAAAAAAAGG + Intergenic