ID: 1134265604

View in Genome Browser
Species Human (GRCh38)
Location 16:12690201-12690223
Sequence ATGGTGTCTTTCATGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134265604_1134265611 25 Left 1134265604 16:12690201-12690223 CCCTGTTTCATGAAAGACACCAT No data
Right 1134265611 16:12690249-12690271 TGCGTATAACCACAGCACTTTGG No data
1134265604_1134265607 -5 Left 1134265604 16:12690201-12690223 CCCTGTTTCATGAAAGACACCAT No data
Right 1134265607 16:12690219-12690241 ACCATCAAGAAGGCCAAGTGTGG 0: 1
1: 0
2: 0
3: 24
4: 229
1134265604_1134265613 29 Left 1134265604 16:12690201-12690223 CCCTGTTTCATGAAAGACACCAT No data
Right 1134265613 16:12690253-12690275 TATAACCACAGCACTTTGGGAGG 0: 8
1: 831
2: 36662
3: 347807
4: 253735
1134265604_1134265609 -2 Left 1134265604 16:12690201-12690223 CCCTGTTTCATGAAAGACACCAT No data
Right 1134265609 16:12690222-12690244 ATCAAGAAGGCCAAGTGTGGTGG No data
1134265604_1134265612 26 Left 1134265604 16:12690201-12690223 CCCTGTTTCATGAAAGACACCAT No data
Right 1134265612 16:12690250-12690272 GCGTATAACCACAGCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134265604 Original CRISPR ATGGTGTCTTTCATGAAACA GGG (reversed) Intronic
No off target data available for this crispr