ID: 1134266864

View in Genome Browser
Species Human (GRCh38)
Location 16:12700393-12700415
Sequence AGACCTCTGTGTTCAACACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134266864_1134266867 12 Left 1134266864 16:12700393-12700415 CCACGTGTTGAACACAGAGGTCT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1134266867 16:12700428-12700450 TTGCCCAAGGTGGAGTGCAGTGG 0: 43
1: 3094
2: 78757
3: 188983
4: 232919
1134266864_1134266865 -1 Left 1134266864 16:12700393-12700415 CCACGTGTTGAACACAGAGGTCT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1134266865 16:12700415-12700437 TGAACATGCTCTGTTGCCCAAGG No data
1134266864_1134266866 2 Left 1134266864 16:12700393-12700415 CCACGTGTTGAACACAGAGGTCT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1134266866 16:12700418-12700440 ACATGCTCTGTTGCCCAAGGTGG No data
1134266864_1134266870 23 Left 1134266864 16:12700393-12700415 CCACGTGTTGAACACAGAGGTCT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1134266870 16:12700439-12700461 GGAGTGCAGTGGCATGATCTCGG 0: 17815
1: 61234
2: 118559
3: 130491
4: 106622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134266864 Original CRISPR AGACCTCTGTGTTCAACACG TGG (reversed) Intronic
902941277 1:19801630-19801652 AGACAAGTGTGTTCAACACAAGG - Intergenic
903456500 1:23490918-23490940 TGACCTCTGGGTTCAGCAGGTGG - Intergenic
903948094 1:26976790-26976812 AGGCCTCAGGGTTCAACAGGTGG + Intergenic
906382363 1:45340917-45340939 AGGCCTGTGTGTAGAACACGTGG + Intronic
907442000 1:54484753-54484775 AGACCTCTGTGGTCTAGAGGTGG + Intergenic
915045868 1:153015187-153015209 AGACATCTGTGTTCATGACCTGG - Intergenic
916091089 1:161308470-161308492 AGACCTTTTTGTTCTACAGGAGG + Intronic
920061947 1:203232988-203233010 AGACCTCTCAGTTCTACACATGG - Intronic
920691571 1:208150864-208150886 AGACCTCTGGGTTCTACTCTTGG + Intronic
921560162 1:216647981-216648003 GGACTGCTGTGGTCAACACGGGG + Intronic
922193202 1:223338115-223338137 ATATCACTGTGTTCAACATGGGG - Intronic
922574202 1:226651465-226651487 AGCCCTCTGTGTTCAAGGAGGGG + Intronic
1063573404 10:7238169-7238191 AGACCCCTGAGTTAAACAAGGGG + Intronic
1063960079 10:11299629-11299651 AGGCCTCTGTTTTCCTCACGTGG - Intronic
1064117458 10:12591132-12591154 ACCCCTCTGTGTCTAACACGGGG - Intronic
1071256770 10:83878479-83878501 AGCCCTGTGTGTTCAAGACTGGG - Intergenic
1073433193 10:103500128-103500150 GGTGCTCTGGGTTCAACACGGGG - Intronic
1076027629 10:127129565-127129587 AGACCTCAGGGGTCAACAGGTGG - Intronic
1078095297 11:8292689-8292711 AGACATCTGTGTTCCACCCCTGG - Intergenic
1083813919 11:65121332-65121354 GGACGTCTGTGTTCAACATGAGG + Intronic
1089294002 11:117457313-117457335 AGACCTCTGGGTTCCTCACAGGG + Intronic
1091802577 12:3333931-3333953 AGACCTCAGTCTCCAACACAGGG - Intergenic
1091817952 12:3453891-3453913 TGTCCTCAGCGTTCAACACGGGG + Intronic
1093910132 12:24737812-24737834 AGATCTCTGTTTTCAACTGGGGG + Intergenic
1094879212 12:34696717-34696739 TGACGTGTGTGTTCAACACATGG + Intergenic
1097893495 12:64801591-64801613 AGTGCCCTGTGTTCAACAGGAGG - Intronic
1101841447 12:108330449-108330471 AGACATCTGGGTTCAACTAGAGG + Intronic
1102458925 12:113088028-113088050 AGCCCTCTGTGCTCTACAGGTGG - Intronic
1107190238 13:37574832-37574854 AGACTTCAGAGTTCAACACCTGG - Intronic
1113330078 13:109318769-109318791 AGCACTCTGTGTTTAACTCGGGG - Intergenic
1119085033 14:71731700-71731722 AGAAATCTGTGTCCCACACGTGG + Intronic
1125715120 15:41815339-41815361 AGCTCTCTGTGTTCCACAGGCGG - Exonic
1126961408 15:54000567-54000589 AGACCTCTGTGAAGAACAAGAGG - Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1130285182 15:82548846-82548868 TGACCTCTGTGATTAACATGTGG - Intronic
1134266864 16:12700393-12700415 AGACCTCTGTGTTCAACACGTGG - Intronic
1135193442 16:20374452-20374474 AGACCTTTATGTGCAACACCAGG - Intronic
1137042289 16:35624258-35624280 AGACCAATCTGTTCAACACAAGG - Intergenic
1137812304 16:51364488-51364510 AGACCTCTGATTTCATCATGTGG - Intergenic
1141391880 16:83671637-83671659 AGAGATCTGTGCTCAAAACGTGG + Intronic
1141720292 16:85751779-85751801 AGACCTCTGTGTCCACACCGCGG - Intergenic
1142573080 17:887974-887996 AGACCTCTCTGTTTTACACGAGG - Intronic
1143742967 17:8967169-8967191 AGGCCTCTGTGTTCAACCAAGGG - Intergenic
1158836889 18:61340051-61340073 ACAACTCTGTGTTCAACATCTGG + Intronic
1160307228 18:77751324-77751346 AGACCTCAGTGTTCAGCTTGCGG - Intergenic
1160866135 19:1256935-1256957 GGTCCTCTGTGTTCAGCAGGTGG + Intronic
936039673 2:109140733-109140755 AGGCCTATGTGCTCTACACGTGG + Intronic
936059205 2:109283484-109283506 AGACCTTTGTGGACAACACCAGG - Intronic
937304610 2:120863474-120863496 AGAACTGTGTGTTCTTCACGTGG - Intronic
937378520 2:121354655-121354677 AGGCCTCTGTTTTCAAAACCTGG + Intronic
946326703 2:218988328-218988350 AGAACTCTGTGTTCAAATCCTGG + Intergenic
1170374472 20:15685408-15685430 AGACATCTGTGTTCACCTCCTGG - Intronic
1171974265 20:31584094-31584116 AGACATCTGTGAACAACAAGTGG - Intergenic
1179797507 21:43793953-43793975 AGACCTCATGGTTCAACAAGAGG - Intronic
1184478729 22:44735392-44735414 AGACCTCCGTGTTCCCCAGGAGG + Intronic
949355086 3:3171839-3171861 AGACCTCTGTGTTGCCCAGGTGG - Intronic
950915701 3:16642938-16642960 AGATCACTGTGTTCAACTGGAGG - Intronic
960348193 3:116560938-116560960 AGACCTCTGGGGTCAATATGGGG - Intronic
965347361 3:167568432-167568454 AGACCTGTATTTTCAATACGAGG + Intronic
969642216 4:8405672-8405694 AGACCTCTGTGTACAACTGGTGG - Intronic
971609198 4:28700372-28700394 AGTCCTCTTTCTTCAACACATGG + Intergenic
971723696 4:30280946-30280968 AGACATCTGTGTTTAATACCAGG + Intergenic
976496715 4:85738792-85738814 AAAATACTGTGTTCAACACGTGG - Intronic
978348938 4:107801181-107801203 AGACCTCTGTATTCTACCCCAGG + Intergenic
986855201 5:11860397-11860419 AAACCTCTGTGTTAAACATTAGG - Intronic
996597995 5:125227146-125227168 AGAGTTCTGTGTTAAACACAAGG + Intergenic
997810766 5:136965947-136965969 ATTCCTCAGTGTTCAACACATGG - Intergenic
997909023 5:137850378-137850400 ACACCTATGTGTTCAACAGTAGG + Intergenic
1002271613 5:178076068-178076090 AGACGTCTGTGAGCAACACCAGG + Intergenic
1002972962 6:2043211-2043233 AGACCTCTCTGTTCAAAGCAAGG + Intronic
1004607907 6:17211219-17211241 AGAAATCTGTGTTCAATATGAGG + Intergenic
1013880317 6:114891267-114891289 AGACCTTTATATTCAACAGGGGG + Intergenic
1014269105 6:119316002-119316024 AGACCTCTGTGGTCAATGTGAGG + Intronic
1019658720 7:2211668-2211690 AGAAGTCTGTGTTCTACAGGGGG + Intronic
1024398052 7:48891333-48891355 AGACCTCTGTTTTCCTCATGGGG + Intergenic
1029174229 7:98652576-98652598 CGACCTCTGTGTTCAACCCAGGG + Intergenic
1038489611 8:27960657-27960679 AGACTTCTGGGTTCAAATCGAGG - Intronic
1042842180 8:73135040-73135062 AGACTTCAGAGATCAACACGGGG + Intergenic
1044455480 8:92388004-92388026 AGACCTCAGTCTACAACAAGTGG - Intergenic
1045822899 8:106362052-106362074 TGACCTCTGTGTTTAGCAGGTGG - Intronic
1048796130 8:138151842-138151864 AGACCTTTGGTTTCAACACCTGG + Exonic
1052886490 9:33653731-33653753 AGAACTCTTTATTCAACACATGG - Intergenic
1055082969 9:72285325-72285347 AGACCTATGTGTGTAACAGGAGG + Intergenic
1059170199 9:112117379-112117401 AGGCCTCTGTGTTCTACAACTGG - Intronic
1060242037 9:121912282-121912304 AGGCCTCTGTGGTCAACCTGAGG + Intronic
1060382764 9:123192206-123192228 AGACCTCTCTGCTGAACACTAGG - Intronic
1190064088 X:47228744-47228766 AGAACTCGGTGTCCACCACGCGG - Exonic
1191865894 X:65703538-65703560 AAACCTCTGTTTTCAACCCCAGG - Intronic
1194931871 X:99898615-99898637 AGACCTCTCTGTTTAACAGATGG - Intergenic
1195924838 X:110015093-110015115 AGACCTCAGTCTTGAAAACGAGG - Intronic
1197384461 X:125786397-125786419 AGGCCACTGGGTTAAACACGGGG - Intergenic