ID: 1134271649

View in Genome Browser
Species Human (GRCh38)
Location 16:12737996-12738018
Sequence CTGGGGATAAGTGGTTAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134271642_1134271649 20 Left 1134271642 16:12737953-12737975 CCAGGACAAAGTCATCATGGAAA No data
Right 1134271649 16:12737996-12738018 CTGGGGATAAGTGGTTAACACGG No data
1134271640_1134271649 29 Left 1134271640 16:12737944-12737966 CCTGTTCTACCAGGACAAAGTCA No data
Right 1134271649 16:12737996-12738018 CTGGGGATAAGTGGTTAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134271649 Original CRISPR CTGGGGATAAGTGGTTAACA CGG Intronic
No off target data available for this crispr