ID: 1134273517

View in Genome Browser
Species Human (GRCh38)
Location 16:12755577-12755599
Sequence ATAAAGATACATATTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134273517_1134273520 1 Left 1134273517 16:12755577-12755599 CCTGCCTCAATATGTATCTTTAT No data
Right 1134273520 16:12755601-12755623 TGTCTACTTGTTAGGATGTTAGG No data
1134273517_1134273519 -7 Left 1134273517 16:12755577-12755599 CCTGCCTCAATATGTATCTTTAT No data
Right 1134273519 16:12755593-12755615 TCTTTATGTGTCTACTTGTTAGG No data
1134273517_1134273521 2 Left 1134273517 16:12755577-12755599 CCTGCCTCAATATGTATCTTTAT No data
Right 1134273521 16:12755602-12755624 GTCTACTTGTTAGGATGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134273517 Original CRISPR ATAAAGATACATATTGAGGC AGG (reversed) Intronic
No off target data available for this crispr