ID: 1134275182

View in Genome Browser
Species Human (GRCh38)
Location 16:12769653-12769675
Sequence CGGGCTCATACTGGATGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134275179_1134275182 -8 Left 1134275179 16:12769638-12769660 CCTGGATGATTTCACCGGGCTCA No data
Right 1134275182 16:12769653-12769675 CGGGCTCATACTGGATGTGAAGG No data
1134275175_1134275182 24 Left 1134275175 16:12769606-12769628 CCTCAGCAGAAGGGCGGCATTGT No data
Right 1134275182 16:12769653-12769675 CGGGCTCATACTGGATGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134275182 Original CRISPR CGGGCTCATACTGGATGTGA AGG Intronic
No off target data available for this crispr