ID: 1134278977

View in Genome Browser
Species Human (GRCh38)
Location 16:12801546-12801568
Sequence ATCCCCAGCATTACTAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134278977_1134278980 12 Left 1134278977 16:12801546-12801568 CCACATCTAGTAATGCTGGGGAT No data
Right 1134278980 16:12801581-12801603 TAACCCAGAACATAGCTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134278977 Original CRISPR ATCCCCAGCATTACTAGATG TGG (reversed) Intronic
No off target data available for this crispr