ID: 1134283532

View in Genome Browser
Species Human (GRCh38)
Location 16:12839354-12839376
Sequence CTGCTTCCAAAATGCAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134283532_1134283533 15 Left 1134283532 16:12839354-12839376 CCATCATTGCATTTTGGAAGCAG No data
Right 1134283533 16:12839392-12839414 CTTTCACATTTCCACAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134283532 Original CRISPR CTGCTTCCAAAATGCAATGA TGG (reversed) Intergenic
No off target data available for this crispr