ID: 1134286511

View in Genome Browser
Species Human (GRCh38)
Location 16:12866762-12866784
Sequence CGGACTAATGCAGCTTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134286508_1134286511 15 Left 1134286508 16:12866724-12866746 CCTAAAGTTCTGGGATTACAGAT 0: 151
1: 7674
2: 99520
3: 326836
4: 238212
Right 1134286511 16:12866762-12866784 CGGACTAATGCAGCTTTTCTTGG No data
1134286504_1134286511 25 Left 1134286504 16:12866714-12866736 CCTTCAGCCTCCTAAAGTTCTGG No data
Right 1134286511 16:12866762-12866784 CGGACTAATGCAGCTTTTCTTGG No data
1134286503_1134286511 28 Left 1134286503 16:12866711-12866733 CCTCCTTCAGCCTCCTAAAGTTC No data
Right 1134286511 16:12866762-12866784 CGGACTAATGCAGCTTTTCTTGG No data
1134286507_1134286511 18 Left 1134286507 16:12866721-12866743 CCTCCTAAAGTTCTGGGATTACA 0: 251
1: 14078
2: 320920
3: 267815
4: 148162
Right 1134286511 16:12866762-12866784 CGGACTAATGCAGCTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134286511 Original CRISPR CGGACTAATGCAGCTTTTCT TGG Intergenic
No off target data available for this crispr