ID: 1134287946

View in Genome Browser
Species Human (GRCh38)
Location 16:12878939-12878961
Sequence GTGTCTAATTTTAAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134287946_1134287950 0 Left 1134287946 16:12878939-12878961 CCTACCACCTTAAAATTAGACAC No data
Right 1134287950 16:12878962-12878984 TCACACAGGCGCGTATTCACAGG No data
1134287946_1134287951 5 Left 1134287946 16:12878939-12878961 CCTACCACCTTAAAATTAGACAC No data
Right 1134287951 16:12878967-12878989 CAGGCGCGTATTCACAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134287946 Original CRISPR GTGTCTAATTTTAAGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr