ID: 1134289036

View in Genome Browser
Species Human (GRCh38)
Location 16:12888646-12888668
Sequence AGGCCTTTGACCTGTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134289032_1134289036 14 Left 1134289032 16:12888609-12888631 CCCAAGTGTTGGGGTTACAGGTG 0: 115
1: 6793
2: 90218
3: 224239
4: 251405
Right 1134289036 16:12888646-12888668 AGGCCTTTGACCTGTTTTCCAGG No data
1134289024_1134289036 28 Left 1134289024 16:12888595-12888617 CCCGACTTGACCTCCCCAAGTGT No data
Right 1134289036 16:12888646-12888668 AGGCCTTTGACCTGTTTTCCAGG No data
1134289031_1134289036 15 Left 1134289031 16:12888608-12888630 CCCCAAGTGTTGGGGTTACAGGT 0: 2
1: 187
2: 8437
3: 107568
4: 331318
Right 1134289036 16:12888646-12888668 AGGCCTTTGACCTGTTTTCCAGG No data
1134289033_1134289036 13 Left 1134289033 16:12888610-12888632 CCAAGTGTTGGGGTTACAGGTGT 0: 2
1: 172
2: 1387
3: 2945
4: 4153
Right 1134289036 16:12888646-12888668 AGGCCTTTGACCTGTTTTCCAGG No data
1134289029_1134289036 18 Left 1134289029 16:12888605-12888627 CCTCCCCAAGTGTTGGGGTTACA No data
Right 1134289036 16:12888646-12888668 AGGCCTTTGACCTGTTTTCCAGG No data
1134289025_1134289036 27 Left 1134289025 16:12888596-12888618 CCGACTTGACCTCCCCAAGTGTT No data
Right 1134289036 16:12888646-12888668 AGGCCTTTGACCTGTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134289036 Original CRISPR AGGCCTTTGACCTGTTTTCC AGG Intergenic
No off target data available for this crispr