ID: 1134289968

View in Genome Browser
Species Human (GRCh38)
Location 16:12896541-12896563
Sequence CAATCATCTGTAACATCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134289965_1134289968 -4 Left 1134289965 16:12896522-12896544 CCCACTTTATGCAAAGTATCAAT No data
Right 1134289968 16:12896541-12896563 CAATCATCTGTAACATCCCTGGG No data
1134289966_1134289968 -5 Left 1134289966 16:12896523-12896545 CCACTTTATGCAAAGTATCAATC No data
Right 1134289968 16:12896541-12896563 CAATCATCTGTAACATCCCTGGG No data
1134289964_1134289968 -1 Left 1134289964 16:12896519-12896541 CCACCCACTTTATGCAAAGTATC No data
Right 1134289968 16:12896541-12896563 CAATCATCTGTAACATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134289968 Original CRISPR CAATCATCTGTAACATCCCT GGG Intergenic
No off target data available for this crispr