ID: 1134290529

View in Genome Browser
Species Human (GRCh38)
Location 16:12900786-12900808
Sequence CGGCGCCGCCTCTGCGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134290529_1134290538 16 Left 1134290529 16:12900786-12900808 CCGGGAGCGCAGAGGCGGCGCCG No data
Right 1134290538 16:12900825-12900847 GGAGCGCAGAAAACGCTGCGGGG No data
1134290529_1134290537 15 Left 1134290529 16:12900786-12900808 CCGGGAGCGCAGAGGCGGCGCCG No data
Right 1134290537 16:12900824-12900846 TGGAGCGCAGAAAACGCTGCGGG No data
1134290529_1134290531 -5 Left 1134290529 16:12900786-12900808 CCGGGAGCGCAGAGGCGGCGCCG No data
Right 1134290531 16:12900804-12900826 CGCCGCGGTGTTCCCTCCTGTGG No data
1134290529_1134290539 17 Left 1134290529 16:12900786-12900808 CCGGGAGCGCAGAGGCGGCGCCG No data
Right 1134290539 16:12900826-12900848 GAGCGCAGAAAACGCTGCGGGGG No data
1134290529_1134290541 26 Left 1134290529 16:12900786-12900808 CCGGGAGCGCAGAGGCGGCGCCG No data
Right 1134290541 16:12900835-12900857 AAACGCTGCGGGGGCGAAGAGGG No data
1134290529_1134290536 14 Left 1134290529 16:12900786-12900808 CCGGGAGCGCAGAGGCGGCGCCG No data
Right 1134290536 16:12900823-12900845 GTGGAGCGCAGAAAACGCTGCGG No data
1134290529_1134290540 25 Left 1134290529 16:12900786-12900808 CCGGGAGCGCAGAGGCGGCGCCG No data
Right 1134290540 16:12900834-12900856 AAAACGCTGCGGGGGCGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134290529 Original CRISPR CGGCGCCGCCTCTGCGCTCC CGG (reversed) Intergenic
No off target data available for this crispr