ID: 1134290537

View in Genome Browser
Species Human (GRCh38)
Location 16:12900824-12900846
Sequence TGGAGCGCAGAAAACGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134290529_1134290537 15 Left 1134290529 16:12900786-12900808 CCGGGAGCGCAGAGGCGGCGCCG No data
Right 1134290537 16:12900824-12900846 TGGAGCGCAGAAAACGCTGCGGG No data
1134290527_1134290537 21 Left 1134290527 16:12900780-12900802 CCAGATCCGGGAGCGCAGAGGCG No data
Right 1134290537 16:12900824-12900846 TGGAGCGCAGAAAACGCTGCGGG No data
1134290532_1134290537 -5 Left 1134290532 16:12900806-12900828 CCGCGGTGTTCCCTCCTGTGGAG No data
Right 1134290537 16:12900824-12900846 TGGAGCGCAGAAAACGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134290537 Original CRISPR TGGAGCGCAGAAAACGCTGC GGG Intergenic
No off target data available for this crispr