ID: 1134290541

View in Genome Browser
Species Human (GRCh38)
Location 16:12900835-12900857
Sequence AAACGCTGCGGGGGCGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134290532_1134290541 6 Left 1134290532 16:12900806-12900828 CCGCGGTGTTCCCTCCTGTGGAG No data
Right 1134290541 16:12900835-12900857 AAACGCTGCGGGGGCGAAGAGGG No data
1134290529_1134290541 26 Left 1134290529 16:12900786-12900808 CCGGGAGCGCAGAGGCGGCGCCG No data
Right 1134290541 16:12900835-12900857 AAACGCTGCGGGGGCGAAGAGGG No data
1134290534_1134290541 -5 Left 1134290534 16:12900817-12900839 CCTCCTGTGGAGCGCAGAAAACG No data
Right 1134290541 16:12900835-12900857 AAACGCTGCGGGGGCGAAGAGGG No data
1134290535_1134290541 -8 Left 1134290535 16:12900820-12900842 CCTGTGGAGCGCAGAAAACGCTG No data
Right 1134290541 16:12900835-12900857 AAACGCTGCGGGGGCGAAGAGGG No data
1134290533_1134290541 -4 Left 1134290533 16:12900816-12900838 CCCTCCTGTGGAGCGCAGAAAAC No data
Right 1134290541 16:12900835-12900857 AAACGCTGCGGGGGCGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134290541 Original CRISPR AAACGCTGCGGGGGCGAAGA GGG Intergenic
No off target data available for this crispr