ID: 1134290881

View in Genome Browser
Species Human (GRCh38)
Location 16:12902199-12902221
Sequence CTCCGGAGGCGGCCCCGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134290881_1134290889 -2 Left 1134290881 16:12902199-12902221 CCGCTCCGGGGCCGCCTCCGGAG 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1134290889 16:12902220-12902242 AGAGGCCAGCGAGGGCGCTGAGG 0: 1
1: 0
2: 2
3: 42
4: 380
1134290881_1134290886 -10 Left 1134290881 16:12902199-12902221 CCGCTCCGGGGCCGCCTCCGGAG 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1134290886 16:12902212-12902234 GCCTCCGGAGAGGCCAGCGAGGG 0: 1
1: 0
2: 0
3: 11
4: 162
1134290881_1134290892 21 Left 1134290881 16:12902199-12902221 CCGCTCCGGGGCCGCCTCCGGAG 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1134290892 16:12902243-12902265 CATCGGACGCGCCCCCGACCCGG 0: 1
1: 0
2: 0
3: 3
4: 24
1134290881_1134290893 22 Left 1134290881 16:12902199-12902221 CCGCTCCGGGGCCGCCTCCGGAG 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1134290893 16:12902244-12902266 ATCGGACGCGCCCCCGACCCGGG 0: 1
1: 0
2: 0
3: 6
4: 35
1134290881_1134290891 4 Left 1134290881 16:12902199-12902221 CCGCTCCGGGGCCGCCTCCGGAG 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1134290891 16:12902226-12902248 CAGCGAGGGCGCTGAGGCATCGG 0: 1
1: 0
2: 0
3: 7
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134290881 Original CRISPR CTCCGGAGGCGGCCCCGGAG CGG (reversed) Exonic
900137916 1:1126263-1126285 CTCCCGGGGCGGCACCGGCGTGG + Intergenic
900149967 1:1174003-1174025 CTCGGGAGGCTGCTCAGGAGAGG + Intronic
902330165 1:15727394-15727416 CTCCCGGGGATGCCCCGGAGAGG + Exonic
902896871 1:19485390-19485412 CTCCGGAGGGGCCCCCGGGCCGG + Intronic
905749658 1:40451023-40451045 ATCCAAAGGCGGCCACGGAGCGG + Exonic
905906019 1:41619017-41619039 CTGTGGAGGCTGCCCTGGAGGGG - Intronic
907442923 1:54489573-54489595 CTCCGGCGGCGGCCCCTAGGGGG - Intergenic
913222036 1:116667568-116667590 GCCCGGAGGGGGCCCCGGGGAGG - Intronic
915322426 1:155063108-155063130 CTCAGGTGGCGGCGGCGGAGGGG - Intergenic
917975267 1:180233937-180233959 CCCCGGAGGAGCCCCAGGAGAGG - Intronic
919403263 1:197146477-197146499 CCCACGAGGCGGCTCCGGAGCGG + Exonic
920302478 1:204997434-204997456 CTGGGGAGGCGGGCCAGGAGGGG - Intronic
922048155 1:221966669-221966691 CTCCGGAGCCGGTCACGGACTGG + Intergenic
922526674 1:226309346-226309368 GGCCGGAGGCGGCGGCGGAGGGG - Exonic
923783021 1:237042487-237042509 CTCGGGAGCCGGCCCCGGCGAGG + Exonic
924172418 1:241356680-241356702 CTCCGGCGGCCGCCGCGGCGCGG - Intronic
1064208810 10:13347323-13347345 CGTCGGAGGCGGCCGGGGAGGGG + Intronic
1067766505 10:49091294-49091316 CTCCTGGGGAGGCCCCAGAGTGG - Intronic
1070767904 10:79067178-79067200 ACCCGGAGGCGGCCCAGGCGGGG - Intergenic
1072637201 10:97185729-97185751 ACCTGGAGGCGGCCCCGGACGGG - Exonic
1072656762 10:97335005-97335027 CCCAGGAGGCGGGCCCGGAGTGG - Intergenic
1074591900 10:114821800-114821822 CTCCGGCGGCGGCACCGGTTGGG - Exonic
1075714924 10:124550549-124550571 CGTGGGAGGCGGCCCCAGAGGGG + Intronic
1076792514 10:132784857-132784879 ATCCGGGGGCGGCCCCGGGTGGG - Exonic
1077112411 11:867714-867736 CTCAGGAGGAGCCCCCGGGGTGG - Intergenic
1077582090 11:3423153-3423175 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1077898787 11:6473908-6473930 GTCCGGCGGCGGCGCCGGCGCGG - Intronic
1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG + Intronic
1084239008 11:67805970-67805992 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1084573593 11:69975003-69975025 CTACGGAGGCAGCCTGGGAGGGG + Intergenic
1084833424 11:71786870-71786892 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
1084892799 11:72244605-72244627 CTGCGGAGGCGGCCCAGGAAGGG + Intronic
1085519179 11:77128191-77128213 CCCAGGAGGCGGAGCCGGAGGGG - Intergenic
1087946296 11:104164279-104164301 CCCCGGCCGCGGCCCCTGAGAGG + Intronic
1090003978 11:122984280-122984302 CTCCGGCGGCAGCGCGGGAGCGG - Intergenic
1092409696 12:8243599-8243621 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1096475700 12:51907563-51907585 GTCCGGGCGCGGCCCCGGACCGG - Exonic
1102244776 12:111348294-111348316 ATCGGGAGGAGGCCCTGGAGTGG + Exonic
1104842235 12:131830631-131830653 CGCCGGAGGCGCTCCCGGAGTGG + Intronic
1104924347 12:132306192-132306214 CTCCGCAGGCGGTTCCGGTGCGG - Intronic
1104989945 12:132619394-132619416 CTCCGGAGGCGACCCTGGGAAGG - Intronic
1105611579 13:21973946-21973968 CTCCCGAGTCGGGCCTGGAGAGG + Intergenic
1106517346 13:30466208-30466230 CTCCGGCGGCCGCTCCGGTGTGG - Intronic
1108323059 13:49305380-49305402 CTCTGGAGCCGGGCCTGGAGGGG - Intergenic
1112205905 13:97322986-97323008 CTCTGGAGGAGGCACTGGAGTGG + Intronic
1113768899 13:112896272-112896294 CTCAGGAGGAGGCCTCGGGGGGG - Intronic
1113858162 13:113460833-113460855 GTTCTGAGGAGGCCCCGGAGTGG + Intronic
1115490203 14:33951133-33951155 TCCCGGAGGCGGTCCCGGGGCGG - Intronic
1117424614 14:55580806-55580828 CTCCGGCGGCGTCCCCGGGCCGG + Intronic
1119410365 14:74426322-74426344 CTCCGGACCCGGCTCCGGGGCGG + Intergenic
1120882975 14:89428903-89428925 CTCCGGAGGCTGCCCAGGCCAGG + Intronic
1122079067 14:99254407-99254429 CTCCAGAGGCAGACCCGAAGGGG - Intronic
1122877816 14:104677027-104677049 CTCCTCAGGCGGCCCTGGGGCGG - Intergenic
1124696915 15:31870866-31870888 CTCCGTGCCCGGCCCCGGAGGGG - Intergenic
1125503421 15:40253065-40253087 GTCGGGAGGCGGGCGCGGAGCGG + Intronic
1128720042 15:69941502-69941524 GCCCGGAGGTGGCCACGGAGGGG + Intergenic
1129793907 15:78361592-78361614 CTCCGGCTGCGGTCCCAGAGAGG - Intergenic
1130390188 15:83447858-83447880 CTCGGGAGGCGGAGACGGAGTGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1131228227 15:90642558-90642580 CTGGGGCGGCGGCACCGGAGAGG + Exonic
1132055793 15:98649413-98649435 CTCCGAAGGCGGCGCCGCCGGGG - Exonic
1132717896 16:1301259-1301281 ATGAGGAGGCGGCCCGGGAGGGG - Intergenic
1133350623 16:5098231-5098253 CTCAGGAGGCGGGGCCGGGGCGG + Intergenic
1133350669 16:5098382-5098404 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1134012613 16:10866500-10866522 CTCCTGGGGTGGGCCCGGAGTGG + Intergenic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1134290882 16:12902202-12902224 CTCCGGGGCCGCCTCCGGAGAGG + Exonic
1137288781 16:47037748-47037770 CTCCGGAGGCGGCGGCTGGGAGG + Intergenic
1137300502 16:47143910-47143932 CTCCGCCCGCGGCCCCGGCGCGG + Exonic
1137725002 16:50651042-50651064 CTCTGCAGGAGGCCCAGGAGGGG - Intergenic
1142697859 17:1643527-1643549 CGCCGGAGGCGGCGCTGCAGCGG + Exonic
1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG + Intronic
1143140522 17:4739659-4739681 CTCCGGCGGCGGGCGAGGAGGGG + Exonic
1143148318 17:4790376-4790398 ATACGGAGGCGGCCGCGGCGCGG - Exonic
1143548522 17:7614614-7614636 CCCCGGAGGAGGAGCCGGAGGGG + Exonic
1146398726 17:32487520-32487542 AGCCTGCGGCGGCCCCGGAGAGG - Exonic
1146488339 17:33261990-33262012 CTCCAGATGCTGCCCTGGAGCGG - Intronic
1148855335 17:50576025-50576047 CACCAGGGGGGGCCCCGGAGAGG - Exonic
1148929955 17:51120294-51120316 CTCCGGGGGCGGCCGGGGCGGGG - Intronic
1149461705 17:56834292-56834314 CTCCGGAGGCCTCCCGAGAGGGG + Intronic
1151481461 17:74372229-74372251 CTACGGAGGAGGGGCCGGAGTGG + Exonic
1151560802 17:74868605-74868627 TTCCGGAGGTGGCCCTGGAGAGG - Intronic
1152212455 17:79009664-79009686 CACCGGAGCCAGCCCCGCAGCGG - Exonic
1152463743 17:80454592-80454614 CCCCGGGGTCGGCCCCGAAGCGG - Intergenic
1152601707 17:81265677-81265699 CTCCGGCTGCGCCCACGGAGGGG - Intronic
1152617046 17:81342822-81342844 CTCCCGAGGCGGCCCCGGCTCGG - Intergenic
1152732282 17:81978090-81978112 CTCCGGGGGACGCCCCGGAATGG - Intronic
1152751812 17:82065750-82065772 GCCCGGCGGCGGCCCCGGCGCGG - Intronic
1154377923 18:13824101-13824123 GTGCGGAGGCGGGCCCGGCGCGG + Intergenic
1157384091 18:47247582-47247604 CTGCGGGGGCTGCCCCGGCGGGG + Intronic
1158652293 18:59299009-59299031 CTCCGGAGGCTGGCGCGGAGTGG - Intronic
1158976338 18:62715140-62715162 TTCCTGAGCCGGCCTCGGAGAGG - Intergenic
1160508282 18:79439335-79439357 CTCCTGGGGCGGGGCCGGAGCGG - Intronic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1161175806 19:2841662-2841684 CGCGGGGGGCGGCCCCGGCGAGG + Intronic
1164835115 19:31350885-31350907 GCCCGGAGCCGGCCCCGGCGCGG - Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165704596 19:37966700-37966722 CTTTGGAGGCAGCCCTGGAGTGG - Intronic
1167384348 19:49155402-49155424 CTCCGGAGACAGCCTCAGAGGGG - Exonic
1168153897 19:54462876-54462898 AGCTGGAGGCGGCCCAGGAGAGG - Exonic
925180080 2:1811821-1811843 CCCAGGAGGGTGCCCCGGAGTGG - Intronic
929885165 2:45871779-45871801 CTCCTGAGACTGCCCCAGAGAGG + Intronic
932572675 2:72946133-72946155 CCCAGGAGGGGGCCCCGGAGTGG - Intronic
937269303 2:120637902-120637924 CTGCAGAGGCGGCCCTGGGGAGG + Intergenic
938264074 2:129913757-129913779 CTCTGGAGGCAGCCCAGGGGTGG + Intergenic
939050992 2:137307847-137307869 CTCCGGAAGCTGACCAGGAGCGG + Intronic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
945063183 2:205925951-205925973 CTCGAGAAGCGGCCCCGGACCGG - Intergenic
946433428 2:219637615-219637637 CCCCTGAGGGGGCCCTGGAGGGG + Exonic
948207297 2:236168847-236168869 CCCCGGGGGTGGCTCCGGAGGGG - Intergenic
1168777737 20:462250-462272 TGGCGGAGGCGGCGCCGGAGGGG - Intronic
1171376109 20:24695049-24695071 GTCCGGAGCCGGCGCCGGCGAGG - Intergenic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1173192507 20:40887216-40887238 GTGCGGAGGCGTCCCCGCAGGGG - Intergenic
1174109396 20:48187663-48187685 CCCATGAGGCGGCCCCAGAGTGG + Intergenic
1176161686 20:63651941-63651963 GGCAGGAGGCGGCCCTGGAGAGG + Intronic
1176178662 20:63739846-63739868 CTCAGGACGCGGCCCCGGGCCGG - Exonic
1176411462 21:6451529-6451551 CTCCGGAGGCGGTACCAGGGCGG - Intergenic
1176550183 21:8217407-8217429 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176556908 21:8257795-8257817 CTCGGGACGGGGCCCCGGCGCGG - Intergenic
1176567946 21:8396613-8396635 CTCGGGACGGGGCCCCGGCGCGG - Intergenic
1176569111 21:8400445-8400467 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176575850 21:8440832-8440854 CTCGGGACGGGGCCCCGGCGCGG - Intergenic
1176577025 21:8444677-8444699 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1179657423 21:42853837-42853859 CTCCTGAGGTGGCACCGGCGAGG - Intronic
1179686955 21:43059851-43059873 CTCCGGAGGCGGTACCAGGGCGG - Intronic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1181804716 22:25367786-25367808 CTCCGGAGCTGGCCCTGGGGTGG - Intronic
1182059401 22:27386220-27386242 CTCAGGAGGCAGCCCAGGAGAGG + Intergenic
1182532373 22:30969832-30969854 CTCTGGCGGCAGCCCCGGGGTGG + Intergenic
1182732017 22:32503489-32503511 CTCCGGCGGCGGTCACGGACTGG + Intergenic
1183537721 22:38412950-38412972 CTCCGGAGGCGGCCACCGGGCGG + Intergenic
1183903358 22:41022239-41022261 CTGCGGAAGCGGCCCGGGCGCGG - Intergenic
1184620417 22:45672230-45672252 CTCCCGCGGCGGCCCCGGCCTGG + Intronic
1184692389 22:46123186-46123208 CTCTGCAGGCGGCCCTGGTGGGG - Intergenic
1185162000 22:49235668-49235690 CGCCGGAGGCAGCCCCGCGGGGG + Intergenic
1203253901 22_KI270733v1_random:129890-129912 CTCGGGACGGGGCCCCGGCGCGG - Intergenic
1203255078 22_KI270733v1_random:133745-133767 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203261957 22_KI270733v1_random:174969-174991 CTCGGGACGGGGCCCCGGCGCGG - Intergenic
1203263134 22_KI270733v1_random:178824-178846 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
952241284 3:31533147-31533169 CGCCGAAGCCGGCCCCGGCGGGG + Exonic
954459278 3:50617259-50617281 CCCCGGAGGAGGCCGCAGAGGGG - Intronic
957054890 3:75435578-75435600 CTCAGGAGGCGGGGCCGGGGCGG + Intergenic
957054935 3:75435729-75435751 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
958985643 3:100776887-100776909 CTCTGGAGGGGGCCCCCAAGTGG + Intronic
961299903 3:125915945-125915967 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
961874731 3:130013469-130013491 CTCCGCAGAAGGCCCCGGTGGGG - Intergenic
961888561 3:130111977-130111999 CTCAGGAGGCGGGGCCGGGGCGG + Intronic
961888607 3:130112128-130112150 CTCAGGAGGCGGGCCCTGGGAGG + Intronic
962865803 3:139447300-139447322 CACAGGAGGCGGCCCCTGACAGG - Intergenic
963236868 3:142964104-142964126 CTCCGGAGGTCGCCGGGGAGGGG + Intergenic
967594845 3:191316961-191316983 CTCCGCCGGCAGCCCCGGCGTGG - Intronic
968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG + Intergenic
968997750 4:3956035-3956057 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
969816627 4:9691966-9691988 CTCAGGAGGCGGGGCCGGGGCGG - Intergenic
984393853 4:179169783-179169805 CTCCGGCGGCGGTCACGGACTGG - Intergenic
990545458 5:56816413-56816435 CTGCGGCGGCGCCCCCGGACGGG + Intronic
990581766 5:57173291-57173313 CTGCCGAGCCGGCGCCGGAGCGG - Intergenic
992269935 5:75053555-75053577 CTGCGGAGGCCGCCCCGGCGGGG + Intergenic
995610878 5:113909254-113909276 CTCCTGAGGGGGCCCTGAAGAGG - Intergenic
1013989712 6:116239443-116239465 TTCCGGAGGCGGCACCACAGAGG + Intronic
1016949449 6:149566259-149566281 CTCCCCGGGCGGCCGCGGAGAGG - Intergenic
1019314775 7:379391-379413 CTTCTGAAGCTGCCCCGGAGGGG + Intergenic
1020259213 7:6521293-6521315 CTTAGGAGGCAGCCCCGGGGAGG + Intronic
1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG + Intergenic
1022914129 7:34929884-34929906 CCCTGGAGGCAGCCCAGGAGAGG - Exonic
1023743648 7:43302601-43302623 CTCCCGGGGCGGCCCCGTACCGG - Intronic
1024748130 7:52431189-52431211 CTCCGCCTGCGGCCCCGGCGCGG - Intergenic
1030049000 7:105521921-105521943 CTGGGAAGGCGGCCCCGCAGTGG - Intronic
1031965779 7:128027305-128027327 CTCCTGAGGGGGCCTGGGAGAGG + Exonic
1035437161 7:158867737-158867759 CTCCCGGGGAGGCCCAGGAGAGG - Intronic
1035584569 8:761849-761871 CTGCGGAGGAGGCCCTGGAGAGG + Intergenic
1036173114 8:6509458-6509480 TTCCGCAGGGGGCCCCGGGGGGG + Intronic
1036379495 8:8227925-8227947 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
1036850064 8:12194688-12194710 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1036871428 8:12436961-12436983 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1039212818 8:35235802-35235824 CACCGCAGGCGGCGGCGGAGGGG + Exonic
1042236024 8:66613582-66613604 GTCCGGAAGCGGCGCCGGAGCGG + Intronic
1047732435 8:127737954-127737976 CCCGGGAGTCGGCCCCGCAGCGG - Intronic
1049621297 8:143599477-143599499 CTCCGGAGGAGGTTGCGGAGTGG + Exonic
1049646935 8:143739723-143739745 CTCGGGAGGAGGCCCGGGTGGGG + Intergenic
1049989310 9:976902-976924 GCCCGGAGGCCGCCCCTGAGCGG + Intergenic
1055454351 9:76459156-76459178 CTCTGGGGGCGGCCCCGGGGCGG + Intronic
1060539416 9:124419694-124419716 CTCTGGAGGTGGCCCCGCAGAGG + Intergenic
1061179366 9:129014650-129014672 CTCCTGAGGCCTCCCCAGAGAGG - Intronic
1061873868 9:133534509-133534531 CGGCGGCGGCGGCCCAGGAGCGG - Intronic
1203470301 Un_GL000220v1:113034-113056 CTCGGGACGGGGCCCCGGCGCGG - Intergenic
1203471476 Un_GL000220v1:116882-116904 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203478122 Un_GL000220v1:157006-157028 CTCGGGACGGGGCCCCGGCGCGG - Intergenic
1203479297 Un_GL000220v1:160854-160876 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1187547324 X:20266779-20266801 CAGCGGCGGCGGCCCCAGAGAGG + Exonic
1190024665 X:46912540-46912562 CGCGGGGGGCGGCCCCGGCGGGG + Exonic
1198619205 X:138488026-138488048 CGCTGGAGGCAGCCCCGCAGGGG - Intergenic