ID: 1134290884

View in Genome Browser
Species Human (GRCh38)
Location 16:12902210-12902232
Sequence CTCGCTGGCCTCTCCGGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134290884_1134290892 10 Left 1134290884 16:12902210-12902232 CCGCCTCCGGAGAGGCCAGCGAG 0: 1
1: 0
2: 1
3: 11
4: 187
Right 1134290892 16:12902243-12902265 CATCGGACGCGCCCCCGACCCGG 0: 1
1: 0
2: 0
3: 3
4: 24
1134290884_1134290891 -7 Left 1134290884 16:12902210-12902232 CCGCCTCCGGAGAGGCCAGCGAG 0: 1
1: 0
2: 1
3: 11
4: 187
Right 1134290891 16:12902226-12902248 CAGCGAGGGCGCTGAGGCATCGG 0: 1
1: 0
2: 0
3: 7
4: 182
1134290884_1134290893 11 Left 1134290884 16:12902210-12902232 CCGCCTCCGGAGAGGCCAGCGAG 0: 1
1: 0
2: 1
3: 11
4: 187
Right 1134290893 16:12902244-12902266 ATCGGACGCGCCCCCGACCCGGG 0: 1
1: 0
2: 0
3: 6
4: 35
1134290884_1134290897 23 Left 1134290884 16:12902210-12902232 CCGCCTCCGGAGAGGCCAGCGAG 0: 1
1: 0
2: 1
3: 11
4: 187
Right 1134290897 16:12902256-12902278 CCCGACCCGGGCGCCCACGCCGG 0: 1
1: 0
2: 0
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134290884 Original CRISPR CTCGCTGGCCTCTCCGGAGG CGG (reversed) Exonic
900227629 1:1540426-1540448 AGCGCTGACCTCTGCGGAGGCGG - Intronic
900527122 1:3134878-3134900 CTCGCCGGGCTCTCAGGAGGTGG - Intronic
901210910 1:7525596-7525618 CTCGCTGTCCTCCCAGGAGCTGG - Intronic
901254467 1:7809969-7809991 CCCACTGGCCTCACTGGAGGAGG - Exonic
901666361 1:10828409-10828431 CTGGCTGGGGCCTCCGGAGGCGG - Intergenic
901667222 1:10833088-10833110 CTGGCTGGCCTGTCAGGAGAGGG - Intergenic
902044219 1:13513302-13513324 CTCGCTGCGCTCGCTGGAGGAGG - Exonic
902762742 1:18594365-18594387 CTTTCTGGACTCTCCGGTGGTGG + Intergenic
903372407 1:22845097-22845119 CTCGCTCACCACTCAGGAGGTGG - Intronic
903828628 1:26161899-26161921 GTCGCTGGCGTCCCCGGAGCCGG - Exonic
904015694 1:27418652-27418674 CTAGCAGGCCTCTCCTTAGGAGG + Intronic
904483359 1:30807602-30807624 CTCGCTGCGCTCTGCGGAGCCGG + Intergenic
904847357 1:33430557-33430579 GGCGCGGGCCTCTCCGCAGGAGG + Intronic
905655216 1:39682448-39682470 CTGGCTGGCCTCCCAGGAGGAGG - Exonic
912471642 1:109910948-109910970 CTCGCTGGCTGCTGCGGAGTGGG - Exonic
915325241 1:155078687-155078709 CGCGCTGGTCTTTCCCGAGGGGG + Intergenic
915724994 1:158011158-158011180 CAGGATGGGCTCTCCGGAGGCGG - Intronic
916612809 1:166409828-166409850 CTCGCTGGGCTCTGTGGGGGTGG + Intergenic
1067841029 10:49679665-49679687 CTCCCTTGCCTCTGCGGCGGCGG + Exonic
1068951559 10:62782521-62782543 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1070779870 10:79131311-79131333 CACTCTGGCCTCTTCGGTGGCGG + Intronic
1070804785 10:79264675-79264697 CTCACAAGCCCCTCCGGAGGTGG - Intronic
1071561519 10:86649798-86649820 CTCGCTGGCATGGCTGGAGGTGG - Intergenic
1073446559 10:103584488-103584510 CACGCAGGGCTCTCGGGAGGCGG - Intronic
1074855057 10:117467274-117467296 CTCCCTGGCCTCGCTGTAGGTGG + Intergenic
1074947708 10:118297242-118297264 CTCACTGGCCTCTCAGAAGATGG + Intergenic
1076688076 10:132207116-132207138 CTCTCTGGTCTCGCTGGAGGAGG - Intergenic
1076750450 10:132539494-132539516 CTCCCTGGTCTCTCCAGAGATGG - Intronic
1076885690 10:133261479-133261501 CGCGCTGGCCTCTGAGGAGGTGG - Intergenic
1077295613 11:1825081-1825103 CTCGCAGGCCTCTCCAGTGCAGG - Intergenic
1078017267 11:7625617-7625639 CTCACTGCCCTCTCCACAGGTGG - Intronic
1078892307 11:15568149-15568171 CTTGCTGGCTTCTCCTGATGTGG + Intergenic
1083207591 11:61161746-61161768 CTCGCTGGCCACTCGGAAGGCGG - Intergenic
1084564509 11:69921464-69921486 GGCTGTGGCCTCTCCGGAGGGGG + Intergenic
1089573283 11:119423605-119423627 CTCACTGGAGGCTCCGGAGGAGG - Exonic
1091240773 11:134050753-134050775 CTGGCTGGTCTCTCCCGAGAAGG + Intergenic
1092405859 12:8221837-8221859 ATCGCTGTCCTCTGAGGAGGAGG + Exonic
1092528348 12:9324521-9324543 CTGGCGAGCCTCCCCGGAGGCGG + Intergenic
1094800076 12:34022791-34022813 CTCTCAGGCCTCTCCTGGGGTGG - Intronic
1096528129 12:52225884-52225906 CTGGCTGCCCTCTGCAGAGGAGG + Intergenic
1097057611 12:56259075-56259097 CTCTCTGGCCTCTCCATTGGAGG - Intergenic
1100520949 12:95375279-95375301 CTCCCTGGCTTCTCCGGAGATGG + Intergenic
1103008425 12:117439570-117439592 GCCGCTGGCCTCTCCAGATGGGG - Intronic
1103681296 12:122696261-122696283 CCTGCTGGCCTCTCTGAAGGGGG - Intergenic
1103683026 12:122709686-122709708 CCTGCTGGCCTCTCTGAAGGGGG - Intergenic
1105752368 13:23433422-23433444 GTCTCTGTCCTCTCCGAAGGCGG + Intronic
1106144483 13:27039410-27039432 CTCCCTTGCCTCTCAGCAGGTGG - Intergenic
1107864146 13:44686994-44687016 CTTGCTTGCCTCTCCCGTGGGGG + Intergenic
1110860575 13:80341252-80341274 CGCCCTCGCCTTTCCGGAGGAGG + Intergenic
1112328618 13:98460341-98460363 CTGGCTGGCCTTTTCGGAGTGGG - Intronic
1114572920 14:23687156-23687178 CTCTCTGCCCTCCCCAGAGGTGG - Intergenic
1117077316 14:52117520-52117542 CTCGCGGGCTGCTCCGGAGCTGG - Intergenic
1118816361 14:69317086-69317108 TTGGCTGCCCTCTCTGGAGGGGG - Intronic
1119487647 14:75002228-75002250 CTCTCTGGCCTCTCTGTAGGAGG + Intergenic
1125083803 15:35706273-35706295 TTCTCTGGCCTCTCTGGAAGTGG + Intergenic
1126592469 15:50354477-50354499 CCCGCCGGGCTCTCCGGAGAGGG - Intronic
1126702494 15:51380736-51380758 CTCACTTGCCTCTCCCCAGGTGG + Intronic
1128770513 15:70278326-70278348 TTCTCTGGCCTCTAGGGAGGAGG + Intergenic
1129563192 15:76593035-76593057 CTTGCTGGCCTCTGTGGGGGTGG - Intronic
1130540272 15:84817142-84817164 CTCCCGGGCCTCTCCAGACGCGG + Exonic
1131188721 15:90295595-90295617 CTCCCTGGCCTCTCCTGGTGCGG - Intronic
1134290884 16:12902210-12902232 CTCGCTGGCCTCTCCGGAGGCGG - Exonic
1135992299 16:27225451-27225473 CTGGCAGCCCTCTCAGGAGGGGG - Intronic
1142074803 16:88111165-88111187 CACGCTGGCCTCTTCGGCAGTGG - Intronic
1142156029 16:88533265-88533287 CGCTCTGGCCTCTCCGTTGGTGG - Exonic
1142617618 17:1145683-1145705 CTTGCTGGCCTCTCTGGACCTGG - Intronic
1142717089 17:1753063-1753085 CTCGCTGGCTTCCCTGGAAGGGG + Intronic
1146627577 17:34445910-34445932 CTAGCTGGCCTCTTCAGATGAGG + Intergenic
1147015664 17:37489792-37489814 CTGGCCGCCCTCTCCCGAGGTGG - Intergenic
1147028368 17:37609231-37609253 CCCGCTGGCCTCCGCGGGGGCGG - Intronic
1147384094 17:40071629-40071651 CTCCCTCGCCTCTGCAGAGGAGG + Intronic
1148093216 17:45034999-45035021 CCCGCTGGCCTCTCCCAAGCAGG - Exonic
1148791169 17:50173814-50173836 CCTGCTGGCCTCCCCGCAGGAGG + Intronic
1149430724 17:56594122-56594144 CTCCCCCGTCTCTCCGGAGGCGG - Exonic
1150811992 17:68363937-68363959 CCCACTGGCCTCTCTGGTGGTGG - Intronic
1151345615 17:73499522-73499544 CACGCTTGCCTCTCGGAAGGGGG + Intronic
1151541761 17:74768211-74768233 CTCGCTGGTGTCACTGGAGGCGG - Exonic
1152477439 17:80527245-80527267 CTCACTGGCCTCTCCTGCGGAGG + Intergenic
1152749375 17:82055611-82055633 CTCGCTGGCCTCTCCTGCCCCGG - Intronic
1153702600 18:7711546-7711568 CTTGCTGGGCTCTGTGGAGGTGG - Intronic
1155209186 18:23586384-23586406 CTGGTTGGGCTCCCCGGAGGCGG + Exonic
1155582407 18:27324539-27324561 CTCTCTGGCCTCACCCCAGGGGG - Intergenic
1157598167 18:48876320-48876342 CTCACTGGCCCCTCCTGTGGCGG + Intergenic
1158558615 18:58495357-58495379 CTCCCTGGCCTCTCCTTGGGTGG + Intronic
1158836279 18:61334199-61334221 CTCGCTGGCCCCGCAGGCGGTGG + Intronic
1159023957 18:63166096-63166118 CTGGCTGGCTTCCTCGGAGGGGG + Intronic
1160719028 19:589658-589680 CGCGCGGGCCTCTCCCCAGGAGG - Intergenic
1160993472 19:1871294-1871316 CCTGCAGGCCTGTCCGGAGGTGG - Intergenic
1161150041 19:2702715-2702737 CTCGCTCCCCTCTGCGGGGGCGG + Intergenic
1161310297 19:3590156-3590178 CTCTCTGGCCTCGCCGATGGCGG - Exonic
1162911086 19:13847960-13847982 CTCGCTGTCCTGGCAGGAGGGGG + Intergenic
1162958937 19:14114812-14114834 ATCCCTGGCCTCTTGGGAGGAGG + Intronic
1163832254 19:19552712-19552734 CTCACTGACCTCTCCCGGGGAGG + Intergenic
1167264134 19:48474967-48474989 CCCGCTGGTCCCTCCGCAGGAGG + Intronic
1167266560 19:48485657-48485679 CTCGGGGGCCTCCCCAGAGGCGG + Exonic
1167633433 19:50639632-50639654 CTCTCTGGCCACCCCGGGGGAGG - Intronic
1168104280 19:54157012-54157034 TTCTCTTGCCTCTCCTGAGGGGG + Exonic
929257759 2:39830904-39830926 CTTGCTGGGCTCTGTGGAGGGGG + Intergenic
930264742 2:49186412-49186434 CTTGCTGGGCTCTCTGGGGGTGG + Intergenic
930720245 2:54631214-54631236 CTTGCTGGCCTCTCCCAGGGAGG - Exonic
935345604 2:102104817-102104839 ATGGCTGGCCTCCCAGGAGGTGG - Intronic
936637969 2:114280964-114280986 CTCACTGGGCTCACCTGAGGTGG - Intergenic
945100479 2:206258172-206258194 CTAGCTGTCCTCTAGGGAGGTGG + Intergenic
947006248 2:225514558-225514580 CTCCCTGGCCTCTTCGTAGGAGG + Intronic
947844187 2:233231017-233231039 GTCGCTGGCCTCCCTGGAGCTGG + Intronic
948995548 2:241576434-241576456 CTCGTTTGCCTCTCCAGCGGTGG + Intergenic
1168890593 20:1293453-1293475 CCCGCAGGCCTCTCCCCAGGTGG - Intronic
1169397052 20:5241646-5241668 CTTGCTGGCCTCTGCGGAGGTGG + Intergenic
1169530504 20:6480326-6480348 CTAGCTGGCAGCTCAGGAGGAGG + Intergenic
1174506822 20:51022716-51022738 CGCCCTGGCCTCCCCGCAGGCGG + Intronic
1175859423 20:62142654-62142676 CTCGCTGGCCTGGCCGGTGGCGG - Intronic
1175905795 20:62378721-62378743 CTCGTGGGCCTCCCAGGAGGTGG + Intergenic
1176243179 20:64084322-64084344 CCCGCTGGGCTCTCCGCAGTCGG + Exonic
1176430031 21:6569795-6569817 CTCACAGGCCTCTGCGGATGTGG - Intergenic
1177425879 21:20922315-20922337 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1179705425 21:43177257-43177279 CTCACAGGCCTCTGCGGATGTGG - Intergenic
1180256672 21:46634733-46634755 CTGGTTAGCCTCTCCAGAGGTGG + Intergenic
1183199676 22:36377195-36377217 CTCGCTGTCCTCTGCGGGTGAGG - Intronic
1185192897 22:49450028-49450050 ATCGCTGGCCTTTCCTGTGGGGG - Intronic
949504547 3:4714610-4714632 CTCTCCAGCCTCTCCTGAGGTGG + Intronic
950707861 3:14794020-14794042 CTTGCTCGCCTCTCCTGATGGGG + Intergenic
954838764 3:53494077-53494099 CTCCCTGGCTGCTCCGGAGCGGG - Intergenic
958586233 3:96091404-96091426 CTTGCTGGGCTCCACGGAGGTGG - Intergenic
961123538 3:124395316-124395338 CTCGCTGGGCTCCCCGAGGGAGG - Exonic
962367762 3:134797123-134797145 CTCGCTTGCTTTTCCGAAGGTGG + Intronic
968230673 3:197003119-197003141 CGCGCGGGCCGCGCCGGAGGAGG - Exonic
969447538 4:7253702-7253724 CTCCCTGGCCCCTCAGGAGCTGG - Intronic
969760270 4:9176130-9176152 GTCGCTGTCCTCTGAGGAGGAGG - Exonic
970441384 4:16083493-16083515 CTCCCTGGCCCCTCAGCAGGTGG - Intronic
971827430 4:31644113-31644135 CCCGCTTGCCTCTCCTGAGATGG - Intergenic
972755552 4:42042273-42042295 CTTTCTGGGCTCTCTGGAGGTGG - Intronic
981662504 4:147184096-147184118 CTTGCTGGACTCTCAGGGGGTGG - Intergenic
987474211 5:18370790-18370812 CTTGCTGGCCACTCCAGCGGAGG + Intergenic
991969584 5:72126173-72126195 CTTCCTGGTCTCTCCGGAGGGGG - Intronic
994142869 5:96361257-96361279 CTTGCTGGGCTCTGCGGGGGTGG + Intergenic
995915159 5:117236638-117236660 CACGGGGGCCTGTCCGGAGGGGG - Intergenic
1001964695 5:175901973-175901995 CTCGCTGGGAGCTCCGAAGGTGG - Intergenic
1011623935 6:89268405-89268427 CTCCCAGGCATCTCTGGAGGAGG - Intronic
1014753687 6:125280452-125280474 CTTGCTGGGCTCTGTGGAGGTGG - Intronic
1017777239 6:157689725-157689747 CTCGGTGGCCTCTGTGGAGAAGG - Intergenic
1019100425 6:169625397-169625419 CTCCCTGGCCTCTCAGTAGTTGG - Intronic
1019273731 7:164962-164984 GTGGCTGGCCTGTCCGGGGGAGG + Intergenic
1019337184 7:491034-491056 CTCCCAGCCCTCTCCGGAAGGGG + Intergenic
1020753431 7:12170784-12170806 CTTGCTGGCCTCTATGGGGGTGG + Intergenic
1020884341 7:13803621-13803643 CTTGCTGGGCTCTCTGGGGGTGG - Intergenic
1032966438 7:137103603-137103625 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1036263893 8:7259877-7259899 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036265189 8:7267499-7267521 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036266490 8:7275121-7275143 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036267796 8:7282743-7282765 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036269099 8:7290365-7290387 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036270393 8:7297987-7298009 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036297492 8:7549068-7549090 ATCGCTGTCCTCTGAGGAGGAGG + Intergenic
1036298796 8:7556715-7556737 ATCGCTGTCCTCTGAGGAGGAGG + Intergenic
1036300101 8:7564365-7564387 ATCGCTGTCCTCTGAGGAGGAGG + Intergenic
1036301405 8:7572010-7572032 ATCGCTGTCCTCTGAGGAGGAGG + Intergenic
1036302702 8:7579659-7579681 ATCGCTGTCCTCTGAGGAGGAGG + Intergenic
1036315933 8:7718416-7718438 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036317240 8:7726064-7726086 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036318548 8:7733712-7733734 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036319857 8:7741359-7741381 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036321164 8:7749007-7749029 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036322473 8:7756655-7756677 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036323781 8:7764303-7764325 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036325083 8:7771951-7771973 ATCGCTGTCCTCTGAGGAGGAGG - Intergenic
1036350961 8:8012357-8012379 ATCGCTGTCCTCTGAGGAGGAGG + Intergenic
1036352259 8:8020003-8020025 ATCGCTGTCCTCTGAGGAGGAGG + Intergenic
1036353558 8:8027651-8027673 ATCGCTGTCCTCTGAGGAGGAGG + Intergenic
1036846245 8:12172776-12172798 ATCGCTGTCCTCTGAGGAGGAGG + Intergenic
1036867611 8:12415095-12415117 ATCGCTGTCCTCTGAGGAGGAGG + Intergenic
1037661985 8:20935644-20935666 CTTGCTGGCTTCTCGGGTGGAGG - Intergenic
1039996859 8:42541686-42541708 CACGCTGCCGGCTCCGGAGGCGG - Intronic
1040391539 8:46954794-46954816 CACTCAAGCCTCTCCGGAGGCGG + Intergenic
1040538324 8:48329061-48329083 CTCACGGGCTTCTCCGGTGGTGG + Intergenic
1041583970 8:59495015-59495037 CTTGCTGGCCTCTGTGGGGGTGG + Intergenic
1041666305 8:60448281-60448303 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1042825308 8:72973646-72973668 CTCCCAGGCTTATCCGGAGGGGG + Intergenic
1046619191 8:116509713-116509735 CTCGCAGCCCTCTCCAGTGGTGG - Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1048589687 8:135809947-135809969 CTCTCTTGCCTCCCTGGAGGTGG + Intergenic
1051814307 9:21087437-21087459 CTTGCTGGCCTCTCTGGGGGTGG - Intergenic
1053614009 9:39744987-39745009 ATCCCTGTCCTCTCGGGAGGGGG - Intergenic
1054239507 9:62597406-62597428 ATCCCTGTCCTCTCGGGAGGGGG + Intergenic
1054553639 9:66631933-66631955 ATCCCTGTCCTCTCGGGAGGGGG + Intergenic
1055742969 9:79409772-79409794 CTCTCTGGGCTCTGCAGAGGTGG + Intergenic
1057266065 9:93619068-93619090 CTCGCTTGCCTGTGCAGAGGTGG + Intronic
1057956839 9:99416498-99416520 CTCCCTAGCCTTTCTGGAGGAGG - Intergenic
1058943115 9:109832834-109832856 CCCGCTGGCCTCTCTGAGGGTGG - Intronic
1060183838 9:121551971-121551993 CTCGGTGGCCTCTGGGTAGGTGG + Intergenic
1062637328 9:137498475-137498497 CTCGCGGGCCTGCCAGGAGGGGG - Intronic
1187839953 X:23476825-23476847 CTTGCTGGGCTCTGTGGAGGTGG + Intergenic
1191153240 X:57242972-57242994 CTTGCTGGGCTTTCCGGGGGTGG - Intergenic
1192141088 X:68647663-68647685 CTCGGTGGCCTTCCAGGAGGCGG + Intronic
1193075178 X:77347700-77347722 CTTGCTGGGCTCCTCGGAGGTGG - Intergenic
1193079333 X:77390418-77390440 CTTGCTGGGCTCTCTGGGGGTGG - Intergenic
1193284636 X:79697211-79697233 CTTGCTGGGCTCTGTGGAGGGGG + Intergenic
1193774197 X:85622655-85622677 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1193878723 X:86896067-86896089 CTTGCTGGGCTCTGTGGAGGTGG - Intergenic
1195112433 X:101660952-101660974 CTCCCTGCCCTGTCAGGAGGAGG + Intergenic
1198518980 X:137433591-137433613 CTTGCTGGGCTCTCTGGGGGTGG - Intergenic