ID: 1134295630

View in Genome Browser
Species Human (GRCh38)
Location 16:12943009-12943031
Sequence CAATTCTGGTTTGCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134295630_1134295634 5 Left 1134295630 16:12943009-12943031 CCAGCAGCTGCAAACCAGAATTG No data
Right 1134295634 16:12943037-12943059 ACAGCTCCAGGCTCCAGAGAAGG No data
1134295630_1134295632 -7 Left 1134295630 16:12943009-12943031 CCAGCAGCTGCAAACCAGAATTG No data
Right 1134295632 16:12943025-12943047 AGAATTGTCCTTACAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134295630 Original CRISPR CAATTCTGGTTTGCAGCTGC TGG (reversed) Intronic
No off target data available for this crispr