ID: 1134296212

View in Genome Browser
Species Human (GRCh38)
Location 16:12948075-12948097
Sequence TGCCAAACCAATTGTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134296210_1134296212 12 Left 1134296210 16:12948040-12948062 CCCTAGTAAGAAAAGACTGTGTA No data
Right 1134296212 16:12948075-12948097 TGCCAAACCAATTGTGTGCCAGG No data
1134296208_1134296212 29 Left 1134296208 16:12948023-12948045 CCTCCATTTATTGTTTTCCCTAG No data
Right 1134296212 16:12948075-12948097 TGCCAAACCAATTGTGTGCCAGG No data
1134296211_1134296212 11 Left 1134296211 16:12948041-12948063 CCTAGTAAGAAAAGACTGTGTAC No data
Right 1134296212 16:12948075-12948097 TGCCAAACCAATTGTGTGCCAGG No data
1134296209_1134296212 26 Left 1134296209 16:12948026-12948048 CCATTTATTGTTTTCCCTAGTAA No data
Right 1134296212 16:12948075-12948097 TGCCAAACCAATTGTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134296212 Original CRISPR TGCCAAACCAATTGTGTGCC AGG Intronic
No off target data available for this crispr