ID: 1134301502

View in Genome Browser
Species Human (GRCh38)
Location 16:12995620-12995642
Sequence CTTAACAGTGGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134301502_1134301508 -5 Left 1134301502 16:12995620-12995642 CCTTCCACCTTCCCACTGTTAAG No data
Right 1134301508 16:12995638-12995660 TTAAGGTCCCTAAGCCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134301502 Original CRISPR CTTAACAGTGGGAAGGTGGA AGG (reversed) Intronic
No off target data available for this crispr