ID: 1134301508

View in Genome Browser
Species Human (GRCh38)
Location 16:12995638-12995660
Sequence TTAAGGTCCCTAAGCCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134301501_1134301508 28 Left 1134301501 16:12995587-12995609 CCAGCAGAAAGGATGTGCTCGGA 0: 1
1: 0
2: 0
3: 3
4: 109
Right 1134301508 16:12995638-12995660 TTAAGGTCCCTAAGCCTCAGAGG No data
1134301504_1134301508 -9 Left 1134301504 16:12995624-12995646 CCACCTTCCCACTGTTAAGGTCC No data
Right 1134301508 16:12995638-12995660 TTAAGGTCCCTAAGCCTCAGAGG No data
1134301499_1134301508 29 Left 1134301499 16:12995586-12995608 CCCAGCAGAAAGGATGTGCTCGG No data
Right 1134301508 16:12995638-12995660 TTAAGGTCCCTAAGCCTCAGAGG No data
1134301502_1134301508 -5 Left 1134301502 16:12995620-12995642 CCTTCCACCTTCCCACTGTTAAG No data
Right 1134301508 16:12995638-12995660 TTAAGGTCCCTAAGCCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134301508 Original CRISPR TTAAGGTCCCTAAGCCTCAG AGG Intronic
No off target data available for this crispr