ID: 1134304738

View in Genome Browser
Species Human (GRCh38)
Location 16:13021966-13021988
Sequence CTGAAATCAAGGCTTTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134304733_1134304738 -3 Left 1134304733 16:13021946-13021968 CCAATTTGGAGGCAGTAAGTCTG No data
Right 1134304738 16:13021966-13021988 CTGAAATCAAGGCTTTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134304738 Original CRISPR CTGAAATCAAGGCTTTGGTG GGG Intronic
No off target data available for this crispr