ID: 1134316583

View in Genome Browser
Species Human (GRCh38)
Location 16:13124373-13124395
Sequence CAGGGTAGGGAGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134316573_1134316583 -1 Left 1134316573 16:13124351-13124373 CCATCTTACCAAACATATTAGCC No data
Right 1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG No data
1134316576_1134316583 -9 Left 1134316576 16:13124359-13124381 CCAAACATATTAGCCAGGGTAGG No data
Right 1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134316583 Original CRISPR CAGGGTAGGGAGATGGAGGA GGG Intronic
No off target data available for this crispr