ID: 1134317498

View in Genome Browser
Species Human (GRCh38)
Location 16:13132660-13132682
Sequence GTAGCCAAACAATCACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134317498_1134317500 4 Left 1134317498 16:13132660-13132682 CCTCCTTGTGATTGTTTGGCTAC No data
Right 1134317500 16:13132687-13132709 GACACATGCTTTCCTGATGAAGG No data
1134317498_1134317503 18 Left 1134317498 16:13132660-13132682 CCTCCTTGTGATTGTTTGGCTAC No data
Right 1134317503 16:13132701-13132723 TGATGAAGGGAAAAATTAACAGG No data
1134317498_1134317501 5 Left 1134317498 16:13132660-13132682 CCTCCTTGTGATTGTTTGGCTAC No data
Right 1134317501 16:13132688-13132710 ACACATGCTTTCCTGATGAAGGG No data
1134317498_1134317504 26 Left 1134317498 16:13132660-13132682 CCTCCTTGTGATTGTTTGGCTAC No data
Right 1134317504 16:13132709-13132731 GGAAAAATTAACAGGCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134317498 Original CRISPR GTAGCCAAACAATCACAAGG AGG (reversed) Intronic
No off target data available for this crispr