ID: 1134326808

View in Genome Browser
Species Human (GRCh38)
Location 16:13215035-13215057
Sequence CACCTGCAAGAGCCTTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134326808_1134326817 11 Left 1134326808 16:13215035-13215057 CCACTGGAAGGCTCTTGCAGGTG No data
Right 1134326817 16:13215069-13215091 GCACTGAGGTGGGTAGAGGATGG No data
1134326808_1134326815 7 Left 1134326808 16:13215035-13215057 CCACTGGAAGGCTCTTGCAGGTG No data
Right 1134326815 16:13215065-13215087 ACCTGCACTGAGGTGGGTAGAGG No data
1134326808_1134326814 1 Left 1134326808 16:13215035-13215057 CCACTGGAAGGCTCTTGCAGGTG No data
Right 1134326814 16:13215059-13215081 GTGGTGACCTGCACTGAGGTGGG No data
1134326808_1134326819 26 Left 1134326808 16:13215035-13215057 CCACTGGAAGGCTCTTGCAGGTG No data
Right 1134326819 16:13215084-13215106 GAGGATGGAGAGAAGAAAATGGG No data
1134326808_1134326812 -3 Left 1134326808 16:13215035-13215057 CCACTGGAAGGCTCTTGCAGGTG No data
Right 1134326812 16:13215055-13215077 GTGGGTGGTGACCTGCACTGAGG No data
1134326808_1134326818 25 Left 1134326808 16:13215035-13215057 CCACTGGAAGGCTCTTGCAGGTG No data
Right 1134326818 16:13215083-13215105 AGAGGATGGAGAGAAGAAAATGG 0: 1
1: 1
2: 26
3: 266
4: 2018
1134326808_1134326813 0 Left 1134326808 16:13215035-13215057 CCACTGGAAGGCTCTTGCAGGTG No data
Right 1134326813 16:13215058-13215080 GGTGGTGACCTGCACTGAGGTGG 0: 1
1: 0
2: 2
3: 32
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134326808 Original CRISPR CACCTGCAAGAGCCTTCCAG TGG (reversed) Intronic
No off target data available for this crispr