ID: 1134326814

View in Genome Browser
Species Human (GRCh38)
Location 16:13215059-13215081
Sequence GTGGTGACCTGCACTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134326807_1134326814 2 Left 1134326807 16:13215034-13215056 CCCACTGGAAGGCTCTTGCAGGT No data
Right 1134326814 16:13215059-13215081 GTGGTGACCTGCACTGAGGTGGG No data
1134326808_1134326814 1 Left 1134326808 16:13215035-13215057 CCACTGGAAGGCTCTTGCAGGTG No data
Right 1134326814 16:13215059-13215081 GTGGTGACCTGCACTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134326814 Original CRISPR GTGGTGACCTGCACTGAGGT GGG Intronic
No off target data available for this crispr