ID: 1134327741

View in Genome Browser
Species Human (GRCh38)
Location 16:13222311-13222333
Sequence CTACTCCGAGTGGTCACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134327730_1134327741 26 Left 1134327730 16:13222262-13222284 CCAAACCATATCATGACCCAAGG No data
Right 1134327741 16:13222311-13222333 CTACTCCGAGTGGTCACTCCAGG No data
1134327735_1134327741 9 Left 1134327735 16:13222279-13222301 CCAAGGAGAGTAATCCAGGTTGG No data
Right 1134327741 16:13222311-13222333 CTACTCCGAGTGGTCACTCCAGG No data
1134327734_1134327741 10 Left 1134327734 16:13222278-13222300 CCCAAGGAGAGTAATCCAGGTTG No data
Right 1134327741 16:13222311-13222333 CTACTCCGAGTGGTCACTCCAGG No data
1134327739_1134327741 -5 Left 1134327739 16:13222293-13222315 CCAGGTTGGTGGGCAGCTCTACT No data
Right 1134327741 16:13222311-13222333 CTACTCCGAGTGGTCACTCCAGG No data
1134327732_1134327741 21 Left 1134327732 16:13222267-13222289 CCATATCATGACCCAAGGAGAGT No data
Right 1134327741 16:13222311-13222333 CTACTCCGAGTGGTCACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134327741 Original CRISPR CTACTCCGAGTGGTCACTCC AGG Intronic
No off target data available for this crispr