ID: 1134340049

View in Genome Browser
Species Human (GRCh38)
Location 16:13336535-13336557
Sequence TGCTTTCTTAAAATAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134340045_1134340049 10 Left 1134340045 16:13336502-13336524 CCCTTGTAGAAAGCACGTAGCAA No data
Right 1134340049 16:13336535-13336557 TGCTTTCTTAAAATAGTTGGAGG No data
1134340043_1134340049 25 Left 1134340043 16:13336487-13336509 CCCAGAAAGGAATTTCCCTTGTA No data
Right 1134340049 16:13336535-13336557 TGCTTTCTTAAAATAGTTGGAGG No data
1134340044_1134340049 24 Left 1134340044 16:13336488-13336510 CCAGAAAGGAATTTCCCTTGTAG No data
Right 1134340049 16:13336535-13336557 TGCTTTCTTAAAATAGTTGGAGG No data
1134340046_1134340049 9 Left 1134340046 16:13336503-13336525 CCTTGTAGAAAGCACGTAGCAAC No data
Right 1134340049 16:13336535-13336557 TGCTTTCTTAAAATAGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134340049 Original CRISPR TGCTTTCTTAAAATAGTTGG AGG Intergenic
No off target data available for this crispr