ID: 1134340800

View in Genome Browser
Species Human (GRCh38)
Location 16:13343915-13343937
Sequence GTGGATTAACAAGGAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134340794_1134340800 22 Left 1134340794 16:13343870-13343892 CCCAGCATCAATACTAATCCATA No data
Right 1134340800 16:13343915-13343937 GTGGATTAACAAGGAGAGAAAGG No data
1134340795_1134340800 21 Left 1134340795 16:13343871-13343893 CCAGCATCAATACTAATCCATAA No data
Right 1134340800 16:13343915-13343937 GTGGATTAACAAGGAGAGAAAGG No data
1134340796_1134340800 4 Left 1134340796 16:13343888-13343910 CCATAAGAAAGTGTTCAGAAAAA No data
Right 1134340800 16:13343915-13343937 GTGGATTAACAAGGAGAGAAAGG No data
1134340793_1134340800 23 Left 1134340793 16:13343869-13343891 CCCCAGCATCAATACTAATCCAT No data
Right 1134340800 16:13343915-13343937 GTGGATTAACAAGGAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134340800 Original CRISPR GTGGATTAACAAGGAGAGAA AGG Intergenic
No off target data available for this crispr