ID: 1134346032

View in Genome Browser
Species Human (GRCh38)
Location 16:13392825-13392847
Sequence CGTGCTTTGCAGGCAGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134346032_1134346035 -6 Left 1134346032 16:13392825-13392847 CCAAAGACTGCCTGCAAAGCACG No data
Right 1134346035 16:13392842-13392864 AGCACGAGAAGCTAAGGCAGAGG No data
1134346032_1134346037 3 Left 1134346032 16:13392825-13392847 CCAAAGACTGCCTGCAAAGCACG No data
Right 1134346037 16:13392851-13392873 AGCTAAGGCAGAGGCCTGGAAGG No data
1134346032_1134346036 -1 Left 1134346032 16:13392825-13392847 CCAAAGACTGCCTGCAAAGCACG No data
Right 1134346036 16:13392847-13392869 GAGAAGCTAAGGCAGAGGCCTGG No data
1134346032_1134346038 4 Left 1134346032 16:13392825-13392847 CCAAAGACTGCCTGCAAAGCACG No data
Right 1134346038 16:13392852-13392874 GCTAAGGCAGAGGCCTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134346032 Original CRISPR CGTGCTTTGCAGGCAGTCTT TGG (reversed) Intergenic
No off target data available for this crispr