ID: 1134347279

View in Genome Browser
Species Human (GRCh38)
Location 16:13402488-13402510
Sequence GTCACCTACATTGGAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134347266_1134347279 27 Left 1134347266 16:13402438-13402460 CCCTTCCTCCGCTTTTTTGTTCT No data
Right 1134347279 16:13402488-13402510 GTCACCTACATTGGAGAGGGTGG No data
1134347275_1134347279 -4 Left 1134347275 16:13402469-13402491 CCTTCGTGGATTGGATGATGTCA No data
Right 1134347279 16:13402488-13402510 GTCACCTACATTGGAGAGGGTGG No data
1134347268_1134347279 22 Left 1134347268 16:13402443-13402465 CCTCCGCTTTTTTGTTCTACTTG No data
Right 1134347279 16:13402488-13402510 GTCACCTACATTGGAGAGGGTGG No data
1134347274_1134347279 -3 Left 1134347274 16:13402468-13402490 CCCTTCGTGGATTGGATGATGTC No data
Right 1134347279 16:13402488-13402510 GTCACCTACATTGGAGAGGGTGG No data
1134347267_1134347279 26 Left 1134347267 16:13402439-13402461 CCTTCCTCCGCTTTTTTGTTCTA No data
Right 1134347279 16:13402488-13402510 GTCACCTACATTGGAGAGGGTGG No data
1134347271_1134347279 19 Left 1134347271 16:13402446-13402468 CCGCTTTTTTGTTCTACTTGGGC No data
Right 1134347279 16:13402488-13402510 GTCACCTACATTGGAGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134347279 Original CRISPR GTCACCTACATTGGAGAGGG TGG Intergenic
No off target data available for this crispr