ID: 1134365179

View in Genome Browser
Species Human (GRCh38)
Location 16:13570627-13570649
Sequence CAGTGTGAACAGTGTGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134365174_1134365179 17 Left 1134365174 16:13570587-13570609 CCAACACACTTCTTCCTGAAGTG No data
Right 1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG No data
1134365176_1134365179 3 Left 1134365176 16:13570601-13570623 CCTGAAGTGCAATGGTCACTTCC No data
Right 1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134365179 Original CRISPR CAGTGTGAACAGTGTGAACA AGG Intergenic
No off target data available for this crispr