ID: 1134365226

View in Genome Browser
Species Human (GRCh38)
Location 16:13570936-13570958
Sequence ATTTTTAAGGGGATCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134365219_1134365226 5 Left 1134365219 16:13570908-13570930 CCATTTGCTCAAGAATTTCTGGG No data
Right 1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134365226 Original CRISPR ATTTTTAAGGGGATCATGAA GGG Intergenic
No off target data available for this crispr