ID: 1134365770

View in Genome Browser
Species Human (GRCh38)
Location 16:13577391-13577413
Sequence GGTAAATGTTCTGTGTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134365770_1134365771 -5 Left 1134365770 16:13577391-13577413 CCAGTACACACAGAACATTTACC No data
Right 1134365771 16:13577409-13577431 TTACCAAAATACACTGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134365770 Original CRISPR GGTAAATGTTCTGTGTGTAC TGG (reversed) Intergenic
No off target data available for this crispr